EMAIL THIS PAGE TO A FRIEND

NAT10

N-acetyltransferase 10 (GCN5-related)

66 Gene Product Result for
Synonyms: ALP NET43
UniProtKB ID: Q9H0A0, Q86WK5, Q9C0F4, Q9HA61, Q9NVF2
Gene ID:
Mouse(98956) N-acetyltransferase 10
Rat(311257) N-acetyltransferase 10 (GCN5-related)
domestic guinea pig(100726257) N-acetyltransferase 10 (GCN5-related)
Domestic Rabbit(100340636) N-acetyltransferase 10 (GCN5-related)
naked mole-rat(101708904) N-acetyltransferase 10 (GCN5-related)
sheep(101103589) N-acetyltransferase 10 (GCN5-related)
Zebrafish(393617) N-acetyltransferase 10
chicken(426609) N-acetyltransferase 10 (GCN5-related)
cow(515001) N-acetyltransferase 10 (GCN5-related)
Horse(100059185) N-acetyltransferase 10 (GCN5-related)
domestic cat(101093393) N-acetyltransferase 10 (GCN5-related)
dog(483431) N-acetyltransferase 10 (GCN5-related)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024662 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024662 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024662 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153126 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153126 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153126 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024662 Rosetta Predictions human pricing
NM_001107756 Rosetta Predictions rat pricing
XR_006980 Rosetta Predictions rat pricing
NM_153126 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024662 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215377 predicted 533
2 SASI_Hs01_00215378 predicted 2415
3 SASI_Hs02_00357064 predicted 2990
4 SASI_Hs01_00215380 predicted 2372
5 SASI_Hs01_00215381 predicted 2677
6 SASI_Hs01_00215382 predicted 2692
7 SASI_Hs01_00215383 predicted 2281
8 SASI_Hs01_00215384 predicted 1826
9 SASI_Hs01_00215385 predicted 691
10 SASI_Hs01_00215386 predicted 2200
11 SASI_Hs01_00215379 predicted 1115
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107756 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231955 predicted 1313
2 SASI_Rn02_00231956 predicted 508
3 SASI_Rn02_00231957 predicted 1152
4 SASI_Rn02_00231958 predicted 2248
5 SASI_Rn02_00231959 predicted 464
6 SASI_Rn02_00231960 predicted 1672
7 SASI_Rn02_00231961 predicted 274
8 SASI_Rn02_00231962 predicted 1944
9 SASI_Rn02_00231963 predicted 408
10 SASI_Rn02_00231964 predicted 552
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_006980 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00139459 predicted 1459
2 SASI_Rn01_00139460 predicted 1307
3 SASI_Rn01_00139461 predicted 2403
4 SASI_Rn01_00139462 predicted 613
5 SASI_Rn01_00139463 predicted 1828
6 SASI_Rn01_00139464 predicted 419
7 SASI_Rn01_00139465 predicted 1986
8 SASI_Rn01_00139466 predicted 3510
9 SASI_Rn01_00139467 predicted 703
10 SASI_Rn01_00139468 predicted 781
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153126 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00342993 predicted 1436
2 SASI_Mm01_00171804 predicted 231
3 SASI_Mm01_00171805 predicted 3258
4 SASI_Mm01_00171807 predicted 595
5 SASI_Mm01_00171808 predicted 1807
6 SASI_Mm01_00171810 predicted 406
7 SASI_Mm01_00171811 predicted 1030
8 SASI_Mm01_00171812 predicted 2993
9 SASI_Mm01_00171813 predicted 237
10 SASI_Mm02_00342994 predicted 3095
11 SASI_Mm01_00171806 predicted 2381
12 SASI_Mm01_00171809 predicted 231
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024662
VALIDATED
NAT10 MISSION shRNA Bacterial Glycerol Stock
N-acetyltransferase 10 (GCN5-related)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024662.1-1238s1c1
Sequence:CCGGCCAGTCTCTAAATCCTGAATTCTCGAGAATTCAGGATTTAGAGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_024662.1-2379s1c1
Sequence:CCGGCGAGCTGGATTTGTTCCTGTTCTCGAGAACAGGAACAAATCCAGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_024662.1-2904s1c1
Sequence:CCGGCGCAAAGTTGTGAAGCTATTTCTCGAGAAATAGCTTCACAACTTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_024662.1-680s1c1
Sequence:CCGGGCAATTGTACACAGTGACTATCTCGAGATAGTCACTGTGTACAATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024662.1-2205s1c1
Sequence:CCGGCCACAGGAAATTCACACCGTACTCGAGTACGGTGTGAATTTCCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_024662.2-2720s21c1
Sequence:CCGGGAGATGTATTCACGGAATATGCTCGAGCATATTCCGTGAATACATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296354    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_024662.2-3583s21c1
Sequence:CCGGAGGGCCCTCCTTTCCTATAAGCTCGAGCTTATAGGAAAGGAGGGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_024662.2-2130s21c1
Sequence:CCGGTTGCTGTTCACCCAGATTATCCTCGAGGATAATCTGGGTGAACAGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_024662.2-718s21c1
Sequence:CCGGGCAATTGTACACAGTGACTATCTCGAGATAGTCACTGTGTACAATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_024662.2-2772s21c1
Sequence:CCGGCGGCCATCTCTCGCATCTATTCTCGAGAATAGATGCGAGAGATGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024662
VALIDATED
NAT10 MISSION shRNA shRNA Plasmid DNA
N-acetyltransferase 10 (GCN5-related)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024662.1-1238s1c1
Sequence:CCGGCCAGTCTCTAAATCCTGAATTCTCGAGAATTCAGGATTTAGAGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_024662.1-2379s1c1
Sequence:CCGGCGAGCTGGATTTGTTCCTGTTCTCGAGAACAGGAACAAATCCAGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_024662.1-2904s1c1
Sequence:CCGGCGCAAAGTTGTGAAGCTATTTCTCGAGAAATAGCTTCACAACTTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_024662.1-680s1c1
Sequence:CCGGGCAATTGTACACAGTGACTATCTCGAGATAGTCACTGTGTACAATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024662.1-2205s1c1
Sequence:CCGGCCACAGGAAATTCACACCGTACTCGAGTACGGTGTGAATTTCCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_024662.2-2720s21c1
Sequence:CCGGGAGATGTATTCACGGAATATGCTCGAGCATATTCCGTGAATACATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296354    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_024662.2-3583s21c1
Sequence:CCGGAGGGCCCTCCTTTCCTATAAGCTCGAGCTTATAGGAAAGGAGGGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_024662.2-2130s21c1
Sequence:CCGGTTGCTGTTCACCCAGATTATCCTCGAGGATAATCTGGGTGAACAGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_024662.2-718s21c1
Sequence:CCGGGCAATTGTACACAGTGACTATCTCGAGATAGTCACTGTGTACAATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_024662.2-2772s21c1
Sequence:CCGGCGGCCATCTCTCGCATCTATTCTCGAGAATAGATGCGAGAGATGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024662
VALIDATED
NAT10 MISSION shRNA Lentiviral Transduction Particles
N-acetyltransferase 10 (GCN5-related)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024662.1-1238s1c1
Sequence:CCGGCCAGTCTCTAAATCCTGAATTCTCGAGAATTCAGGATTTAGAGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_024662.1-2379s1c1
Sequence:CCGGCGAGCTGGATTTGTTCCTGTTCTCGAGAACAGGAACAAATCCAGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_024662.1-2904s1c1
Sequence:CCGGCGCAAAGTTGTGAAGCTATTTCTCGAGAAATAGCTTCACAACTTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_024662.1-680s1c1
Sequence:CCGGGCAATTGTACACAGTGACTATCTCGAGATAGTCACTGTGTACAATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024662.1-2205s1c1
Sequence:CCGGCCACAGGAAATTCACACCGTACTCGAGTACGGTGTGAATTTCCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_024662.2-2720s21c1
Sequence:CCGGGAGATGTATTCACGGAATATGCTCGAGCATATTCCGTGAATACATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296354    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_024662.2-3583s21c1
Sequence:CCGGAGGGCCCTCCTTTCCTATAAGCTCGAGCTTATAGGAAAGGAGGGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_024662.2-2130s21c1
Sequence:CCGGTTGCTGTTCACCCAGATTATCCTCGAGGATAATCTGGGTGAACAGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_024662.2-718s21c1
Sequence:CCGGGCAATTGTACACAGTGACTATCTCGAGATAGTCACTGTGTACAATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_024662.2-2772s21c1
Sequence:CCGGCGGCCATCTCTCGCATCTATTCTCGAGAATAGATGCGAGAGATGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153126
VALIDATED
NAT10 MISSION shRNA Bacterial Glycerol Stock
N-acetyltransferase 10 (GCN5-related)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153126.1-1609s1c1
Sequence:CCGGCCTCCAAGAGTCAATCCGATACTCGAGTATCGGATTGACTCTTGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184285    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153126.1-3398s1c1
Sequence:CCGGGCACCATCGTTCCATCTGTATCTCGAGATACAGATGGAACGATGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153126.1-1643s1c1
Sequence:CCGGGCAGTGGAGAAGTGGCTTAATCTCGAGATTAAGCCACTTCTCCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153126.1-2393s1c1
Sequence:CCGGGCTGGATTTGTTCCTGTCTATCTCGAGATAGACAGGAACAAATCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179570    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153126.1-3432s1c1
Sequence:CCGGGAAGACAAAGTCACTCTTGAACTCGAGTTCAAGAGTGACTTTGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153126.2-2702s21c1
Sequence:CCGGTCTCGGAACATGGTCGATTACCTCGAGGTAATCGACCATGTTCCGAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153126.2-1167s21c1
Sequence:CCGGATAACCTCCACACGCTGTTTGCTCGAGCAAACAGCGTGTGGAGGTTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153126.2-459s21c1
Sequence:CCGGAGAGTGGGACCTTGAACTTAACTCGAGTTAAGTTCAAGGTCCCACTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425541    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153126.2-3511s21c1
Sequence:CCGGACCCAGGTCAGTCTCACTTTGCTCGAGCAAAGTGAGACTGACCTGGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153126.2-1219s21c1
Sequence:CCGGGTATCAGGAGCATCTGGATTACTCGAGTAATCCAGATGCTCCTGATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153126
VALIDATED
NAT10 MISSION shRNA shRNA Plasmid DNA
N-acetyltransferase 10 (GCN5-related)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153126.1-1609s1c1
Sequence:CCGGCCTCCAAGAGTCAATCCGATACTCGAGTATCGGATTGACTCTTGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184285    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153126.1-3398s1c1
Sequence:CCGGGCACCATCGTTCCATCTGTATCTCGAGATACAGATGGAACGATGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153126.1-1643s1c1
Sequence:CCGGGCAGTGGAGAAGTGGCTTAATCTCGAGATTAAGCCACTTCTCCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153126.1-2393s1c1
Sequence:CCGGGCTGGATTTGTTCCTGTCTATCTCGAGATAGACAGGAACAAATCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179570    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153126.1-3432s1c1
Sequence:CCGGGAAGACAAAGTCACTCTTGAACTCGAGTTCAAGAGTGACTTTGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000446016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153126.2-2702s21c1
Sequence:CCGGTCTCGGAACATGGTCGATTACCTCGAGGTAATCGACCATGTTCCGAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000444703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153126.2-1167s21c1
Sequence:CCGGATAACCTCCACACGCTGTTTGCTCGAGCAAACAGCGTGTGGAGGTTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153126.2-459s21c1
Sequence:CCGGAGAGTGGGACCTTGAACTTAACTCGAGTTAAGTTCAAGGTCCCACTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425541    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153126.2-3511s21c1
Sequence:CCGGACCCAGGTCAGTCTCACTTTGCTCGAGCAAAGTGAGACTGACCTGGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153126.2-1219s21c1
Sequence:CCGGGTATCAGGAGCATCTGGATTACTCGAGTAATCCAGATGCTCCTGATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153126
VALIDATED
NAT10 MISSION shRNA Lentiviral Transduction Particles
N-acetyltransferase 10 (GCN5-related)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153126.1-1609s1c1
Sequence:CCGGCCTCCAAGAGTCAATCCGATACTCGAGTATCGGATTGACTCTTGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184285    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153126.1-3398s1c1
Sequence:CCGGGCACCATCGTTCCATCTGTATCTCGAGATACAGATGGAACGATGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153126.1-1643s1c1
Sequence:CCGGGCAGTGGAGAAGTGGCTTAATCTCGAGATTAAGCCACTTCTCCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153126.1-2393s1c1
Sequence:CCGGGCTGGATTTGTTCCTGTCTATCTCGAGATAGACAGGAACAAATCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179570    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153126.1-3432s1c1
Sequence:CCGGGAAGACAAAGTCACTCTTGAACTCGAGTTCAAGAGTGACTTTGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153126.2-2702s21c1
Sequence:CCGGTCTCGGAACATGGTCGATTACCTCGAGGTAATCGACCATGTTCCGAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153126.2-1167s21c1
Sequence:CCGGATAACCTCCACACGCTGTTTGCTCGAGCAAACAGCGTGTGGAGGTTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153126.2-459s21c1
Sequence:CCGGAGAGTGGGACCTTGAACTTAACTCGAGTTAAGTTCAAGGTCCCACTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425541    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153126.2-3511s21c1
Sequence:CCGGACCCAGGTCAGTCTCACTTTGCTCGAGCAAAGTGAGACTGACCTGGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153126.2-1219s21c1
Sequence:CCGGGTATCAGGAGCATCTGGATTACTCGAGTAATCCAGATGCTCCTGATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)