EMAIL THIS PAGE TO A FRIEND

NAT16

N-acetyltransferase 16 (GCN5-related, putative)

20 Gene Product Result for
Synonyms: C7orf52
UniProtKB ID: Q8N8M0, Q8NDR1
Gene ID:
dog(100684972) N-acetyltransferase 16 (GCN5-related, putative)
cow(100139949) N-acetyltransferase 16 (GCN5-related, putative)
domestic cat(101089163) N-acetyltransferase 16 (GCN5-related, putative)
sheep(101119607) N-acetyltransferase 16 (GCN5-related, putative)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA021918 Anti-NAT16 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198571 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198571 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198571 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU160301 MISSION® esiRNA esiRNA human C7orf52 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198571 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198571 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372204 predicted 1200
2 SASI_Hs01_00018054 predicted 451
3 SASI_Hs01_00018055 predicted 1214
4 SASI_Hs01_00018056 predicted 269
5 SASI_Hs01_00018058 predicted 1829
6 SASI_Hs01_00018059 predicted 1509
7 SASI_Hs01_00018060 predicted 1793
8 SASI_Hs01_00018062 predicted 1614
9 SASI_Hs01_00018063 predicted 944
10 SASI_Hs02_00372205 predicted 1828
11 SASI_Hs01_00018057 predicted 473
12 SASI_Hs01_00018061 predicted 1309
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198571
NAT16 MISSION shRNA Bacterial Glycerol Stock
N-acetyltransferase 16 (GCN5-related, putative)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198571.1-744s1c1
Sequence:CCGGGAGCTGAAGAAATACCGCCTACTCGAGTAGGCGGTATTTCTTCAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198571.1-1301s1c1
Sequence:CCGGGCTGGTGAAGGGTTATACTGACTCGAGTCAGTATAACCCTTCACCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160971    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198571.1-2164s1c1
Sequence:CCGGGCTTTGCACAACTTTGCTATTCTCGAGAATAGCAAAGTTGTGCAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164757    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198571.1-2044s1c1
Sequence:CCGGCCAGAGAGAGAGAGAGTGATACTCGAGTATCACTCTCTCTCTCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198571.1-2674s1c1
Sequence:CCGGCGTAGGTGCTAGGAGAATGTTCTCGAGAACATTCTCCTAGCACCTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198571.1-1307s1c1
Sequence:CCGGGAAGGGTTATACTGAACAGTACTCGAGTACTGTTCAGTATAACCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198571.1-752s1c1
Sequence:CCGGGAAATACCGCCTAATCACCAACTCGAGTTGGTGATTAGGCGGTATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165003    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198571.1-2342s1c1
Sequence:CCGGGCCTTCTAGTGCAACTGGAATCTCGAGATTCCAGTTGCACTAGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198571.1-1124s1c1
Sequence:CCGGCTATCTCAACATCGACGCCTTCTCGAGAAGGCGTCGATGTTGAGATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198571.1-746s1c1
Sequence:CCGGGCTGAAGAAATACCGCCTAATCTCGAGATTAGGCGGTATTTCTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198571
NAT16 MISSION shRNA shRNA Plasmid DNA
N-acetyltransferase 16 (GCN5-related, putative)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198571.1-744s1c1
Sequence:CCGGGAGCTGAAGAAATACCGCCTACTCGAGTAGGCGGTATTTCTTCAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198571.1-1301s1c1
Sequence:CCGGGCTGGTGAAGGGTTATACTGACTCGAGTCAGTATAACCCTTCACCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160971    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198571.1-2164s1c1
Sequence:CCGGGCTTTGCACAACTTTGCTATTCTCGAGAATAGCAAAGTTGTGCAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164757    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198571.1-2044s1c1
Sequence:CCGGCCAGAGAGAGAGAGAGTGATACTCGAGTATCACTCTCTCTCTCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198571.1-2674s1c1
Sequence:CCGGCGTAGGTGCTAGGAGAATGTTCTCGAGAACATTCTCCTAGCACCTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198571.1-1307s1c1
Sequence:CCGGGAAGGGTTATACTGAACAGTACTCGAGTACTGTTCAGTATAACCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198571.1-752s1c1
Sequence:CCGGGAAATACCGCCTAATCACCAACTCGAGTTGGTGATTAGGCGGTATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165003    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198571.1-2342s1c1
Sequence:CCGGGCCTTCTAGTGCAACTGGAATCTCGAGATTCCAGTTGCACTAGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198571.1-1124s1c1
Sequence:CCGGCTATCTCAACATCGACGCCTTCTCGAGAAGGCGTCGATGTTGAGATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198571.1-746s1c1
Sequence:CCGGGCTGAAGAAATACCGCCTAATCTCGAGATTAGGCGGTATTTCTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198571
NAT16 MISSION shRNA Lentiviral Transduction Particles
N-acetyltransferase 16 (GCN5-related, putative)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198571.1-744s1c1
Sequence:CCGGGAGCTGAAGAAATACCGCCTACTCGAGTAGGCGGTATTTCTTCAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198571.1-1301s1c1
Sequence:CCGGGCTGGTGAAGGGTTATACTGACTCGAGTCAGTATAACCCTTCACCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160971    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198571.1-2164s1c1
Sequence:CCGGGCTTTGCACAACTTTGCTATTCTCGAGAATAGCAAAGTTGTGCAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164757    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198571.1-2044s1c1
Sequence:CCGGCCAGAGAGAGAGAGAGTGATACTCGAGTATCACTCTCTCTCTCTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198571.1-2674s1c1
Sequence:CCGGCGTAGGTGCTAGGAGAATGTTCTCGAGAACATTCTCCTAGCACCTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198571.1-1307s1c1
Sequence:CCGGGAAGGGTTATACTGAACAGTACTCGAGTACTGTTCAGTATAACCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198571.1-752s1c1
Sequence:CCGGGAAATACCGCCTAATCACCAACTCGAGTTGGTGATTAGGCGGTATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165003    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198571.1-2342s1c1
Sequence:CCGGGCCTTCTAGTGCAACTGGAATCTCGAGATTCCAGTTGCACTAGAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198571.1-1124s1c1
Sequence:CCGGCTATCTCAACATCGACGCCTTCTCGAGAAGGCGTCGATGTTGAGATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198571.1-746s1c1
Sequence:CCGGGCTGAAGAAATACCGCCTAATCTCGAGATTAGGCGGTATTTCTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)