EMAIL THIS PAGE TO A FRIEND

NAT1

N-acetyltransferase 1 (arylamine N-acetyltransferase)

75 Gene Product Result for
Synonyms: AAC1 MNAT NAT-1 NATI
UniProtKB ID: P18440, A8K4E7, O15159, O15300, Q546N1, Q96TE9
Gene ID:
Human(9) Summary: This gene is one of two arylamine N-acetyltransferase (NAT) genes in the human genome, and is orthologous to the mouse and rat Nat2 genes. The enzyme encoded by this gene catalyzes the transfer of an acetyl group from acetyl-CoA to various arylamine and hydrazine substrates. This enzyme helps metabolize drugs and other xenobiotics, and functions in folate catabolism. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Mouse(17960) N-acetyl transferase 1
Rat(116631) N-acetyltransferase 1
fruit fly(46020) CG3845 gene product from transcript CG3845-RA
cow(512603) N-acetyltransferase 1 (arylamine N-acetyltransferase)
domestic cat(101095575) N-acetyltransferase 1 (arylamine N-acetyltransferase)
fruit fly(32934) CG12202 gene product from transcript CG12202-RA
sheep(101120889) N-acetyltransferase 1 (arylamine N-acetyltransferase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000662 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000662 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000662 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008673 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008673 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008673 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU072731 MISSION® esiRNA esiRNA human NAT1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000662 Rosetta Predictions human pricing
NM_001037315 Rosetta Predictions rat pricing
NM_001037316 Rosetta Predictions rat pricing
NM_053853 Rosetta Predictions rat pricing
NM_008673 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000662 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110118 predicted 879
2 SASI_Hs01_00110119 predicted 893
3 SASI_Hs01_00110120 predicted 794
4 SASI_Hs01_00110121 predicted 302
5 SASI_Hs01_00110122 predicted 728
6 SASI_Hs01_00110123 predicted 627
7 SASI_Hs01_00110124 predicted 792
8 SASI_Hs01_00110125 predicted 666
9 SASI_Hs01_00110126 predicted 632
10 SASI_Hs01_00110127 predicted 620
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037315 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064832 predicted 627
2 SASI_Rn02_00204362 predicted 615
3 SASI_Rn01_00064833 predicted 1188
4 SASI_Rn01_00064834 predicted 1282
5 SASI_Rn01_00064835 predicted 1191
6 SASI_Rn01_00064836 predicted 676
7 SASI_Rn01_00064837 predicted 1213
8 SASI_Rn01_00064839 predicted 1259
9 SASI_Rn01_00064840 predicted 1041
10 SASI_Rn02_00204363 predicted 1244
11 SASI_Rn01_00064838 predicted 797
12 SASI_Rn01_00064841 predicted 834
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037316 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087356 predicted 383
2 SASI_Rn02_00204364 predicted 375
3 SASI_Rn01_00087357 predicted 944
4 SASI_Rn01_00087358 predicted 1045
5 SASI_Rn01_00087359 predicted 956
6 SASI_Rn01_00087360 predicted 431
7 SASI_Rn01_00087361 predicted 971
8 SASI_Rn01_00087363 predicted 1019
9 SASI_Rn01_00087364 predicted 800
10 SASI_Rn02_00204365 predicted 1001
11 SASI_Rn01_00087362 predicted 563
12 SASI_Rn01_00087365 predicted 593
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053853 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110743 predicted 780
2 SASI_Rn02_00266707 predicted 770
3 SASI_Rn01_00110744 predicted 1337
4 SASI_Rn01_00110745 predicted 1442
5 SASI_Rn01_00110746 predicted 1346
6 SASI_Rn01_00110747 predicted 824
7 SASI_Rn01_00110748 predicted 1374
8 SASI_Rn01_00110750 predicted 1417
9 SASI_Rn01_00110751 predicted 1187
10 SASI_Rn02_00266708 predicted 1393
11 SASI_Rn01_00110749 predicted 949
12 SASI_Rn01_00110752 predicted 994
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008673 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137689 predicted 1034
2 SASI_Mm01_00137690 predicted 1056
3 SASI_Mm01_00137691 predicted 718
4 SASI_Mm01_00137692 predicted 955
5 SASI_Mm01_00137693 predicted 925
6 SASI_Mm01_00137694 predicted 948
7 SASI_Mm01_00137695 predicted 945
8 SASI_Mm01_00137696 predicted 245
9 SASI_Mm01_00137697 predicted 1054
10 SASI_Mm01_00137698 predicted 243
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000662
VALIDATED
NAT1 MISSION shRNA Bacterial Glycerol Stock
N-acetyltransferase 1 (arylamine N-acetyltransferase)
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000662.5-384s21c1
Sequence:CCGGACTGGGCTCTGACCACTATTGCTCGAGCAATAGTGGTCAGAGCCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000662.4-306s21c1
Sequence:CCGGACTTAGGCTTAGAGGCCATTTCTCGAGAAATGGCCTCTAAGCCTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_000662.4-421s21c1
Sequence:CCGGGATGTTGGGAGGGTATGTTTACTCGAGTAAACATACCCTCCCAACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296211    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_000662.4-1064s21c1
Sequence:CCGGTCATCCAGCTCACCAGTTATCCTCGAGGATAACTGGTGAGCTGGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_000662.4-263s21c1
Sequence:CCGGGTTCCCTTTGAGAACCTTAACCTCGAGGTTAAGGTTCTCAAAGGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344920    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000662.5-1443s21c1
Sequence:CCGGTTTGGAAGACTTAGGATATTACTCGAGTAATATCCTAAGTCTTCCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000662.5-722s21c1
Sequence:CCGGATCTACTCCTTTACTCTTAAGCTCGAGCTTAAGAGTAAAGGAGTAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_000662.4-876s21c1
Sequence:CCGGTCACCCATAGGAGATTCAATTCTCGAGAATTGAATCTCCTATGGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000662.4-386s21c1
Sequence:CCGGTACTGGGCTCTGACCACTATTCTCGAGAATAGTGGTCAGAGCCCAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312651    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000662.4-1063s21c1
Sequence:CCGGGTCATCCAGCTCACCAGTTATCTCGAGATAACTGGTGAGCTGGATGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_000662.5-875s21c1
Sequence:CCGGACCCATAGGAGATTCAATTATCTCGAGATAATTGAATCTCCTATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_000662.4-879s1c1
Sequence:CCGGCCCATAGGAGATTCAATTATACTCGAGTATAATTGAATCTCCTATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000662.4-306s1c1
Sequence:CCGGACTTAGGCTTAGAGGCCATTTCTCGAGAAATGGCCTCTAAGCCTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000662.4-1000s1c1
Sequence:CCGGGCCCAAACATGGTGATAGATTCTCGAGAATCTATCACCATGTTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000662.4-646s1c1
Sequence:CCGGCCAAATCAGAAGGGAACAGTACTCGAGTACTGTTCCCTTCTGATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_000662.4-792s1c1
Sequence:CCGGCATCTCCATCATCTGTGTTTACTCGAGTAAACACAGATGATGGAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000662
VALIDATED
NAT1 MISSION shRNA shRNA Plasmid DNA
N-acetyltransferase 1 (arylamine N-acetyltransferase)
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000662.5-384s21c1
Sequence:CCGGACTGGGCTCTGACCACTATTGCTCGAGCAATAGTGGTCAGAGCCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000662.4-306s21c1
Sequence:CCGGACTTAGGCTTAGAGGCCATTTCTCGAGAAATGGCCTCTAAGCCTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_000662.4-421s21c1
Sequence:CCGGGATGTTGGGAGGGTATGTTTACTCGAGTAAACATACCCTCCCAACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296211    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_000662.4-1064s21c1
Sequence:CCGGTCATCCAGCTCACCAGTTATCCTCGAGGATAACTGGTGAGCTGGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_000662.4-263s21c1
Sequence:CCGGGTTCCCTTTGAGAACCTTAACCTCGAGGTTAAGGTTCTCAAAGGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344920    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000662.5-1443s21c1
Sequence:CCGGTTTGGAAGACTTAGGATATTACTCGAGTAATATCCTAAGTCTTCCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000662.5-722s21c1
Sequence:CCGGATCTACTCCTTTACTCTTAAGCTCGAGCTTAAGAGTAAAGGAGTAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_000662.4-876s21c1
Sequence:CCGGTCACCCATAGGAGATTCAATTCTCGAGAATTGAATCTCCTATGGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000662.4-386s21c1
Sequence:CCGGTACTGGGCTCTGACCACTATTCTCGAGAATAGTGGTCAGAGCCCAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312651    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000662.4-1063s21c1
Sequence:CCGGGTCATCCAGCTCACCAGTTATCTCGAGATAACTGGTGAGCTGGATGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_000662.5-875s21c1
Sequence:CCGGACCCATAGGAGATTCAATTATCTCGAGATAATTGAATCTCCTATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_000662.4-879s1c1
Sequence:CCGGCCCATAGGAGATTCAATTATACTCGAGTATAATTGAATCTCCTATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000662.4-306s1c1
Sequence:CCGGACTTAGGCTTAGAGGCCATTTCTCGAGAAATGGCCTCTAAGCCTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000662.4-1000s1c1
Sequence:CCGGGCCCAAACATGGTGATAGATTCTCGAGAATCTATCACCATGTTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000662.4-646s1c1
Sequence:CCGGCCAAATCAGAAGGGAACAGTACTCGAGTACTGTTCCCTTCTGATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_000662.4-792s1c1
Sequence:CCGGCATCTCCATCATCTGTGTTTACTCGAGTAAACACAGATGATGGAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000662
VALIDATED
NAT1 MISSION shRNA Lentiviral Transduction Particles
N-acetyltransferase 1 (arylamine N-acetyltransferase)
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000662.5-384s21c1
Sequence:CCGGACTGGGCTCTGACCACTATTGCTCGAGCAATAGTGGTCAGAGCCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000662.4-306s21c1
Sequence:CCGGACTTAGGCTTAGAGGCCATTTCTCGAGAAATGGCCTCTAAGCCTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_000662.4-421s21c1
Sequence:CCGGGATGTTGGGAGGGTATGTTTACTCGAGTAAACATACCCTCCCAACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296211    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_000662.4-1064s21c1
Sequence:CCGGTCATCCAGCTCACCAGTTATCCTCGAGGATAACTGGTGAGCTGGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_000662.4-263s21c1
Sequence:CCGGGTTCCCTTTGAGAACCTTAACCTCGAGGTTAAGGTTCTCAAAGGGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344920    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000662.5-1443s21c1
Sequence:CCGGTTTGGAAGACTTAGGATATTACTCGAGTAATATCCTAAGTCTTCCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000662.5-722s21c1
Sequence:CCGGATCTACTCCTTTACTCTTAAGCTCGAGCTTAAGAGTAAAGGAGTAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_000662.4-876s21c1
Sequence:CCGGTCACCCATAGGAGATTCAATTCTCGAGAATTGAATCTCCTATGGGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000662.4-386s21c1
Sequence:CCGGTACTGGGCTCTGACCACTATTCTCGAGAATAGTGGTCAGAGCCCAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312651    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000662.4-1063s21c1
Sequence:CCGGGTCATCCAGCTCACCAGTTATCTCGAGATAACTGGTGAGCTGGATGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_000662.5-875s21c1
Sequence:CCGGACCCATAGGAGATTCAATTATCTCGAGATAATTGAATCTCCTATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_000662.4-879s1c1
Sequence:CCGGCCCATAGGAGATTCAATTATACTCGAGTATAATTGAATCTCCTATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000662.4-306s1c1
Sequence:CCGGACTTAGGCTTAGAGGCCATTTCTCGAGAAATGGCCTCTAAGCCTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000662.4-1000s1c1
Sequence:CCGGGCCCAAACATGGTGATAGATTCTCGAGAATCTATCACCATGTTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000662.4-646s1c1
Sequence:CCGGCCAAATCAGAAGGGAACAGTACTCGAGTACTGTTCCCTTCTGATTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_000662.4-792s1c1
Sequence:CCGGCATCTCCATCATCTGTGTTTACTCGAGTAAACACAGATGATGGAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008673
NAT1 MISSION shRNA Bacterial Glycerol Stock
N-acetyltransferase 1 (arylamine N-acetyltransferase)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000099530    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008673.1-1190s1c1
Sequence:CCGGCCAACTAATGACTTGTTGTATCTCGAGATACAACAAGTCATTAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008673.1-1058s1c1
Sequence:CCGGCCAAACATGGTGAACTAGTTTCTCGAGAAACTAGTTCACCATGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008673.1-926s1c1
Sequence:CCGGCCACCTTTACAAGTAGGAGATCTCGAGATCTCCTACTTGTAAAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008673.1-508s1c1
Sequence:CCGGGTCAGCAAATATAGCAGTGAACTCGAGTTCACTGCTATATTTGCTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008673
NAT1 MISSION shRNA shRNA Plasmid DNA
N-acetyltransferase 1 (arylamine N-acetyltransferase)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000099530    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008673.1-1190s1c1
Sequence:CCGGCCAACTAATGACTTGTTGTATCTCGAGATACAACAAGTCATTAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008673.1-1058s1c1
Sequence:CCGGCCAAACATGGTGAACTAGTTTCTCGAGAAACTAGTTCACCATGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008673.1-926s1c1
Sequence:CCGGCCACCTTTACAAGTAGGAGATCTCGAGATCTCCTACTTGTAAAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008673.1-508s1c1
Sequence:CCGGGTCAGCAAATATAGCAGTGAACTCGAGTTCACTGCTATATTTGCTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008673
NAT1 MISSION shRNA Lentiviral Transduction Particles
N-acetyltransferase 1 (arylamine N-acetyltransferase)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000099530    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008673.1-1190s1c1
Sequence:CCGGCCAACTAATGACTTGTTGTATCTCGAGATACAACAAGTCATTAGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008673.1-1058s1c1
Sequence:CCGGCCAAACATGGTGAACTAGTTTCTCGAGAAACTAGTTCACCATGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008673.1-926s1c1
Sequence:CCGGCCACCTTTACAAGTAGGAGATCTCGAGATCTCCTACTTGTAAAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008673.1-508s1c1
Sequence:CCGGGTCAGCAAATATAGCAGTGAACTCGAGTTCACTGCTATATTTGCTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)