EMAIL THIS PAGE TO A FRIEND

NAT6

N-acetyltransferase 6 (GCN5-related)

53 Gene Product Result for
Synonyms: FUS-2 FUS2
UniProtKB ID: Q93015, Q93014
Gene ID:
Human(24142) Summary: This gene encodes a member of the N-acetyltransferase family. N-acetyltransferases modify proteins by transferring acetyl groups from acetyl CoA to the N-termini of protein substrates. The encoded protein is a cytoplasmic N-acetyltransferase with a substrate specificity for proteins with an N-terminal methionine. This gene is located in the tumor suppressor gene region on chromosome 3p21.3 and the encoded protein may play a role in cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed. This gene overlaps and is on the same strand as hyaluronoglucosaminidase 3, and some transcripts of each gene share a portion of the first exon. [provided by RefSeq, Jan 2011]
Mouse(56441) N-acetyltransferase 6
sheep(101115660) N-acetyltransferase 6 (GCN5-related)
domestic guinea pig(100715918) N-acetyltransferase 6 (GCN5-related)
dog(608612) N-acetyltransferase 6 (GCN5-related)
domestic cat(101093170) N-acetyltransferase 6 (GCN5-related)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019750 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019750 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019750 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012191 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012191 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012191 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU219511 MISSION® esiRNA esiRNA targeting human NAT6 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012191 Rosetta Predictions human pricing
NM_019750 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012191 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041197 predicted 284
2 SASI_Hs01_00041198 predicted 922
3 SASI_Hs01_00041199 predicted 651
4 SASI_Hs01_00041200 predicted 229
5 SASI_Hs01_00041201 predicted 707
6 SASI_Hs01_00041202 predicted 222
7 SASI_Hs01_00041203 predicted 874
8 SASI_Hs01_00041204 predicted 838
9 SASI_Hs01_00041205 predicted 869
10 SASI_Hs01_00041206 predicted 220
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019750 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039465 predicted 891
2 SASI_Mm01_00039467 predicted 1303
3 SASI_Mm01_00039468 predicted 1765
4 SASI_Mm01_00039469 predicted 1459
5 SASI_Mm01_00039471 predicted 1558
6 SASI_Mm01_00039472 predicted 1159
7 SASI_Mm01_00039473 predicted 924
8 SASI_Mm02_00324913 predicted 1726
9 SASI_Mm01_00039474 predicted 1596
10 SASI_Mm02_00324914 predicted 907
11 SASI_Mm01_00039466 predicted 1540
12 SASI_Mm01_00039470 predicted 1767
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019750
VALIDATED
NAT6 MISSION shRNA Bacterial Glycerol Stock
N-acetyltransferase 6 (GCN5-related)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000306778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019750.3-926s21c1
Sequence:CCGGCCTGAGATTCAACCTGTCCAACTCGAGTTGGACAGGTTGAATCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019750.3-1820s21c1
Sequence:CCGGGACACTGGATTGCCCAGAACACTCGAGTGTTCTGGGCAATCCAGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019750.3-1770s21c1
Sequence:CCGGTGCCCTATATTCTGGATGGAACTCGAGTTCCATCCAGAATATAGGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019750.3-1478s21c1
Sequence:CCGGGCTGTACTTCTATGCCCATCTCTCGAGAGATGGGCATAGAAGTACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019750.3-1734s21c1
Sequence:CCGGAGCCCACTAGAGACATGCTATCTCGAGATAGCATGTCTCTAGTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019750.2-1503s1c1
Sequence:CCGGGCTGTACTTCTATGCCCATCTCTCGAGAGATGGGCATAGAAGTACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019750.2-951s1c1
Sequence:CCGGCCTGAGATTCAACCTGTCCAACTCGAGTTGGACAGGTTGAATCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019750.2-1759s1c1
Sequence:CCGGAGCCCACTAGAGACATGCTATCTCGAGATAGCATGTCTCTAGTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019750.2-1336s1c1
Sequence:CCGGGCCCGCTTATCACGGGTACTACTCGAGTAGTACCCGTGATAAGCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019750.2-1795s1c1
Sequence:CCGGTGCCCTATATTCTGGATGGAACTCGAGTTCCATCCAGAATATAGGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019750
VALIDATED
NAT6 MISSION shRNA shRNA Plasmid DNA
N-acetyltransferase 6 (GCN5-related)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000306778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019750.3-926s21c1
Sequence:CCGGCCTGAGATTCAACCTGTCCAACTCGAGTTGGACAGGTTGAATCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019750.3-1820s21c1
Sequence:CCGGGACACTGGATTGCCCAGAACACTCGAGTGTTCTGGGCAATCCAGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019750.3-1770s21c1
Sequence:CCGGTGCCCTATATTCTGGATGGAACTCGAGTTCCATCCAGAATATAGGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019750.3-1478s21c1
Sequence:CCGGGCTGTACTTCTATGCCCATCTCTCGAGAGATGGGCATAGAAGTACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019750.3-1734s21c1
Sequence:CCGGAGCCCACTAGAGACATGCTATCTCGAGATAGCATGTCTCTAGTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019750.2-1503s1c1
Sequence:CCGGGCTGTACTTCTATGCCCATCTCTCGAGAGATGGGCATAGAAGTACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019750.2-951s1c1
Sequence:CCGGCCTGAGATTCAACCTGTCCAACTCGAGTTGGACAGGTTGAATCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019750.2-1759s1c1
Sequence:CCGGAGCCCACTAGAGACATGCTATCTCGAGATAGCATGTCTCTAGTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019750.2-1336s1c1
Sequence:CCGGGCCCGCTTATCACGGGTACTACTCGAGTAGTACCCGTGATAAGCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019750.2-1795s1c1
Sequence:CCGGTGCCCTATATTCTGGATGGAACTCGAGTTCCATCCAGAATATAGGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019750
VALIDATED
NAT6 MISSION shRNA Lentiviral Transduction Particles
N-acetyltransferase 6 (GCN5-related)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000306778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019750.3-926s21c1
Sequence:CCGGCCTGAGATTCAACCTGTCCAACTCGAGTTGGACAGGTTGAATCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019750.3-1820s21c1
Sequence:CCGGGACACTGGATTGCCCAGAACACTCGAGTGTTCTGGGCAATCCAGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019750.3-1770s21c1
Sequence:CCGGTGCCCTATATTCTGGATGGAACTCGAGTTCCATCCAGAATATAGGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019750.3-1478s21c1
Sequence:CCGGGCTGTACTTCTATGCCCATCTCTCGAGAGATGGGCATAGAAGTACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019750.3-1734s21c1
Sequence:CCGGAGCCCACTAGAGACATGCTATCTCGAGATAGCATGTCTCTAGTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019750.2-1503s1c1
Sequence:CCGGGCTGTACTTCTATGCCCATCTCTCGAGAGATGGGCATAGAAGTACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019750.2-951s1c1
Sequence:CCGGCCTGAGATTCAACCTGTCCAACTCGAGTTGGACAGGTTGAATCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019750.2-1759s1c1
Sequence:CCGGAGCCCACTAGAGACATGCTATCTCGAGATAGCATGTCTCTAGTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019750.2-1336s1c1
Sequence:CCGGGCCCGCTTATCACGGGTACTACTCGAGTAGTACCCGTGATAAGCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019750.2-1795s1c1
Sequence:CCGGTGCCCTATATTCTGGATGGAACTCGAGTTCCATCCAGAATATAGGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012191
VALIDATED
NAT6 MISSION shRNA Bacterial Glycerol Stock
N-acetyltransferase 6 (GCN5-related)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012191.2-743s21c1
Sequence:CCGGCTGCCTGCCACCCTGCTTAATCTCGAGATTAAGCAGGGTGGCAGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271517    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012191.2-1002s21c1
Sequence:CCGGCAGGGCAAGGAACTGTCTTTCCTCGAGGAAAGACAGTTCCTTGCCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012191.2-253s21c1
Sequence:CCGGGCTTACCCTGGATCCTGAACACTCGAGTGTTCAGGATCCAGGGTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012191.2-110s21c1
Sequence:CCGGCCTACACTAGACCCTACACACCTCGAGGTGTGTAGGGTCTAGTGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012191.2-663s21c1
Sequence:CCGGATGACCAGGTGCACTTCTATACTCGAGTATAGAAGTGCACCTGGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012191.2-228s1c1
Sequence:CCGGTGACCTTCAATCCTGGTCCAACTCGAGTTGGACCAGGATTGAAGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012191.2-356s1c1
Sequence:CCGGTGTGCTGACCTCATCAATGATCTCGAGATCATTGATGAGGTCAGCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012191.2-926s1c1
Sequence:CCGGAGCCTGCTGGAGACACAATATCTCGAGATATTGTGTCTCCAGCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012191.2-482s1c1
Sequence:CCGGGCACCCGTTGTGGTGGGCCATCTCGAGATGGCCCACCACAACGGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012191.2-871s1c1
Sequence:CCGGCCTACCTGAGTGCCTGACCATCTCGAGATGGTCAGGCACTCAGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012191
VALIDATED
NAT6 MISSION shRNA shRNA Plasmid DNA
N-acetyltransferase 6 (GCN5-related)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012191.2-743s21c1
Sequence:CCGGCTGCCTGCCACCCTGCTTAATCTCGAGATTAAGCAGGGTGGCAGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271517    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012191.2-1002s21c1
Sequence:CCGGCAGGGCAAGGAACTGTCTTTCCTCGAGGAAAGACAGTTCCTTGCCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012191.2-253s21c1
Sequence:CCGGGCTTACCCTGGATCCTGAACACTCGAGTGTTCAGGATCCAGGGTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012191.2-110s21c1
Sequence:CCGGCCTACACTAGACCCTACACACCTCGAGGTGTGTAGGGTCTAGTGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012191.2-663s21c1
Sequence:CCGGATGACCAGGTGCACTTCTATACTCGAGTATAGAAGTGCACCTGGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012191.2-228s1c1
Sequence:CCGGTGACCTTCAATCCTGGTCCAACTCGAGTTGGACCAGGATTGAAGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012191.2-356s1c1
Sequence:CCGGTGTGCTGACCTCATCAATGATCTCGAGATCATTGATGAGGTCAGCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012191.2-926s1c1
Sequence:CCGGAGCCTGCTGGAGACACAATATCTCGAGATATTGTGTCTCCAGCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012191.2-482s1c1
Sequence:CCGGGCACCCGTTGTGGTGGGCCATCTCGAGATGGCCCACCACAACGGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012191.2-871s1c1
Sequence:CCGGCCTACCTGAGTGCCTGACCATCTCGAGATGGTCAGGCACTCAGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012191
VALIDATED
NAT6 MISSION shRNA Lentiviral Transduction Particles
N-acetyltransferase 6 (GCN5-related)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012191.2-743s21c1
Sequence:CCGGCTGCCTGCCACCCTGCTTAATCTCGAGATTAAGCAGGGTGGCAGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271517    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012191.2-1002s21c1
Sequence:CCGGCAGGGCAAGGAACTGTCTTTCCTCGAGGAAAGACAGTTCCTTGCCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012191.2-253s21c1
Sequence:CCGGGCTTACCCTGGATCCTGAACACTCGAGTGTTCAGGATCCAGGGTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012191.2-110s21c1
Sequence:CCGGCCTACACTAGACCCTACACACCTCGAGGTGTGTAGGGTCTAGTGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012191.2-663s21c1
Sequence:CCGGATGACCAGGTGCACTTCTATACTCGAGTATAGAAGTGCACCTGGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012191.2-228s1c1
Sequence:CCGGTGACCTTCAATCCTGGTCCAACTCGAGTTGGACCAGGATTGAAGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012191.2-356s1c1
Sequence:CCGGTGTGCTGACCTCATCAATGATCTCGAGATCATTGATGAGGTCAGCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012191.2-926s1c1
Sequence:CCGGAGCCTGCTGGAGACACAATATCTCGAGATATTGTGTCTCCAGCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012191.2-482s1c1
Sequence:CCGGGCACCCGTTGTGGTGGGCCATCTCGAGATGGCCCACCACAACGGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012191.2-871s1c1
Sequence:CCGGCCTACCTGAGTGCCTGACCATCTCGAGATGGTCAGGCACTCAGGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)