EMAIL THIS PAGE TO A FRIEND

NAT8B

N-acetyltransferase 8B (GCN5-related, putative, gene/pseudogene)

33 Gene Product Result for
Synonyms: CML2 Hcml2 NAT8BP
UniProtKB ID: Q9UHF3, Q0VAD9, Q6NT18
Gene ID:
Human(51471) Summary: The protein encoded by this gene is highly similar to the N-acetyltransferase 8 (NAT8) gene product, which is a kidney and liver protein with homology to bacterial acetyltransferases involved in drug resistance. This gene is localized on chromosome 2 in the vicinity of the NAT8 gene and may represent a pseudogene of NAT8. This gene contains two polymorphic nonsense mutations that disrupt the active site of the protein. The full-length product of this gene contains a complete acetyltransferase domain and is identical in length to NAT8. [provided by RefSeq, Jul 2008]
Mouse(434057) N-acetyltransferase 8B
Rat(171084) N-acetyltransferase 8B
sheep(101104899) N-acetyltransferase 8B (GCN5-related, putative, gene/pseudogene)
chicken(776932) N-acetyltransferase 8B (GCN5-related, putative, gene/pseudogene)
dog(483111) N-acetyltransferase 8B (GCN5-related, putative, gene/pseudogene)
cow(789265) N-acetyltransferase 8B pseudogene
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016347 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016347 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016347 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016347 Rosetta Predictions human pricing
NM_133558 Rosetta Predictions rat pricing
XM_485799 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016347 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014133 predicted 549
2 SASI_Hs01_00014134 predicted 280
3 SASI_Hs01_00014135 predicted 212
4 SASI_Hs02_00349305 predicted 349
5 SASI_Hs01_00014137 predicted 580
6 SASI_Hs02_00349306 predicted 367
7 SASI_Hs01_00014138 predicted 69
8 SASI_Hs01_00014139 predicted 717
9 SASI_Hs01_00014140 predicted 625
10 SASI_Hs01_00014141 predicted 118
11 SASI_Hs01_00014136 predicted 288
12 SASI_Hs01_00014142 predicted 729
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133558 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059178 predicted 732
2 SASI_Rn01_00059179 predicted 713
3 SASI_Rn01_00059180 predicted 715
4 SASI_Rn01_00059181 predicted 153
5 SASI_Rn01_00059182 predicted 767
6 SASI_Rn02_00267750 predicted 838
7 SASI_Rn01_00059183 predicted 724
8 SASI_Rn01_00059184 predicted 835
9 SASI_Rn01_00059185 predicted 792
10 SASI_Rn02_00267751 predicted 183
11 SASI_Rn01_00059176 predicted 660
12 SASI_Rn01_00059177 predicted 727
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_485799 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00426701 predicted 667
2 SASI_Mm02_00426702 predicted 738
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016347
NAT8B MISSION shRNA Bacterial Glycerol Stock
N-acetyltransferase 8B (GCN5-related, putative, gene/pseudogene)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016347.1-283s1c1
Sequence:CCGGCGCGGTATGTAGACATAGCATCTCGAGATGCTATGTCTACATACCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016347.1-625s1c1
Sequence:CCGGGCCAGTCCTTCTTCCACGTGTCTCGAGACACGTGGAAGAAGGACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016347.1-296s1c1
Sequence:CCGGCATAGCATTGCGCACAGACATCTCGAGATGTCTGTGCGCAATGCTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016347.1-74s1c1
Sequence:CCGGCCGCAAGTCGGTCGTGGGCTTCTCGAGAAGCCCACGACCGACTTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016347.1-658s1c1
Sequence:CCGGTGGATCTTCATACAGTTCATTCTCGAGAATGAACTGTATGAAGATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016347
NAT8B MISSION shRNA shRNA Plasmid DNA
N-acetyltransferase 8B (GCN5-related, putative, gene/pseudogene)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016347.1-283s1c1
Sequence:CCGGCGCGGTATGTAGACATAGCATCTCGAGATGCTATGTCTACATACCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016347.1-625s1c1
Sequence:CCGGGCCAGTCCTTCTTCCACGTGTCTCGAGACACGTGGAAGAAGGACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016347.1-296s1c1
Sequence:CCGGCATAGCATTGCGCACAGACATCTCGAGATGTCTGTGCGCAATGCTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016347.1-74s1c1
Sequence:CCGGCCGCAAGTCGGTCGTGGGCTTCTCGAGAAGCCCACGACCGACTTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016347.1-658s1c1
Sequence:CCGGTGGATCTTCATACAGTTCATTCTCGAGAATGAACTGTATGAAGATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016347
NAT8B MISSION shRNA Lentiviral Transduction Particles
N-acetyltransferase 8B (GCN5-related, putative, gene/pseudogene)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016347.1-283s1c1
Sequence:CCGGCGCGGTATGTAGACATAGCATCTCGAGATGCTATGTCTACATACCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016347.1-625s1c1
Sequence:CCGGGCCAGTCCTTCTTCCACGTGTCTCGAGACACGTGGAAGAAGGACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016347.1-296s1c1
Sequence:CCGGCATAGCATTGCGCACAGACATCTCGAGATGTCTGTGCGCAATGCTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016347.1-74s1c1
Sequence:CCGGCCGCAAGTCGGTCGTGGGCTTCTCGAGAAGCCCACGACCGACTTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016347.1-658s1c1
Sequence:CCGGTGGATCTTCATACAGTTCATTCTCGAGAATGAACTGTATGAAGATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)