EMAIL THIS PAGE TO A FRIEND

NAT8L

N-acetyltransferase 8-like (GCN5-related, putative)

63 Gene Product Result for
Synonyms: CML3 NACED NAT8-LIKE
UniProtKB ID: Q8N9F0
Gene ID:
Human(339983) Summary: This gene encodes a single-pass membrane protein, which contains a conserved sequence of the GCN5 or NAT superfamily of N-acetyltransferases and is a member of the N-acyltransferase (NAT) superfamily. This protein is a neuron-specific protein and is the N-acetylaspartate (NAA) biosynthetic enzyme, catalyzing the NAA synthesis from L-aspartate and acetyl-CoA. NAA is a major storage and transport form of acetyl coenzyme A specific to the nervous system. The gene mutation results in primary NAA deficiency (hypoacetylaspartia). [provided by RefSeq, Dec 2010]
Mouse(269642) N-acetyltransferase 8-like
Rat(289727) N-acetyltransferase 8-like
Zebrafish(564754) N-acetyltransferase 8-like
chicken(422893) N-acetyltransferase 8-like (GCN5-related, putative)
cow(614317) N-acetyltransferase 8-like (GCN5-related, putative)
domestic cat(101083676) N-acetyltransferase 8-like (GCN5-related, putative)
dog(612955) N-acetyltransferase 8-like (GCN5-related, putative)
naked mole-rat(101707458) N-acetyltransferase 8-like (GCN5-related, putative)
sheep(101102905) N-acetyltransferase 8-like (GCN5-related, putative)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178557 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178557 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178557 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001001985 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001001985 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001001985 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU065691 MISSION® esiRNA esiRNA targeting mouse Nat8l (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178557 Rosetta Predictions human pricing
XM_001060523 Rosetta Predictions rat pricing
XM_223538 Rosetta Predictions rat pricing
NM_001001985 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178557 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208404 predicted 307
2 SASI_Hs02_00369804 predicted 880
3 SASI_Hs01_00208405 predicted 715
4 SASI_Hs01_00208406 predicted 159
5 SASI_Hs01_00208407 predicted 156
6 SASI_Hs02_00369805 predicted 639
7 SASI_Hs01_00208411 predicted 1472
8 SASI_Hs02_00369806 predicted 1510
9 SASI_Hs02_00369807 predicted 1936
10 SASI_Hs01_00208412 predicted 1572
11 SASI_Hs01_00208408 predicted 402
12 SASI_Hs01_00208409 predicted 1499
13 SASI_Hs01_00208410 predicted 2031
14 SASI_Hs01_00208413 predicted 2163
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060523 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00296822 predicted 932
2 SASI_Rn02_00296823 predicted 1419
3 SASI_Rn02_00296824 predicted 1377
4 SASI_Rn02_00296825 predicted 698
5 SASI_Rn02_00296826 predicted 800
6 SASI_Rn02_00296827 predicted 1173
7 SASI_Rn02_00296828 predicted 1491
8 SASI_Rn02_00296829 predicted 899
9 SASI_Rn02_00296830 predicted 953
10 SASI_Rn02_00296831 predicted 1358
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223538 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381507 predicted 933
2 SASI_Rn02_00381508 predicted 1424
3 SASI_Rn02_00381509 predicted 1376
4 SASI_Rn02_00381510 predicted 695
5 SASI_Rn02_00381511 predicted 801
6 SASI_Rn02_00381512 predicted 1175
7 SASI_Rn02_00381513 predicted 1497
8 SASI_Rn02_00381514 predicted 900
9 SASI_Rn02_00381515 predicted 955
10 SASI_Rn02_00381516 predicted 1360
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001985 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153834 predicted 1595
2 SASI_Mm01_00153835 predicted 1468
3 SASI_Mm01_00153836 predicted 1839
4 SASI_Mm01_00153837 predicted 1841
5 SASI_Mm01_00153838 predicted 1567
6 SASI_Mm01_00153839 predicted 1621
7 SASI_Mm01_00153840 predicted 1805
8 SASI_Mm01_00153841 predicted 1311
9 SASI_Mm01_00153842 predicted 1536
10 SASI_Mm01_00153843 predicted 1641
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178557
NAT8L MISSION shRNA Bacterial Glycerol Stock
N-acetyltransferase 8-like (GCN5-related, putative)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149334    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178557.2-1646s1c1
Sequence:CCGGGAAACCCTGATTGGATGTCATCTCGAGATGACATCCAATCAGGGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147267    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178557.2-1954s1c1
Sequence:CCGGGCAGGAGAAGAATAAACACTTCTCGAGAAGTGTTTATTCTTCTCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146484    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178557.2-1651s1c1
Sequence:CCGGCCTGATTGGATGTCATTTCCTCTCGAGAGGAAATGACATCCAATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148647    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178557.2-1473s1c1
Sequence:CCGGCAGCCTGAAACCAACACATTTCTCGAGAAATGTGTTGGTTTCAGGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147770    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178557.2-1526s1c1
Sequence:CCGGGCATGACTTTAATTCTTGGGACTCGAGTCCCAAGAATTAAAGTCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178557.3-509s21c1
Sequence:CCGGCGGACATCGAGCAGTACTACACTCGAGTGTAGTACTGCTCGATGTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178557.3-1102s21c1
Sequence:CCGGGTGGGTTGTTTGTCGCCATAGCTCGAGCTATGGCGACAAACAACCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178557
NAT8L MISSION shRNA shRNA Plasmid DNA
N-acetyltransferase 8-like (GCN5-related, putative)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149334    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178557.2-1646s1c1
Sequence:CCGGGAAACCCTGATTGGATGTCATCTCGAGATGACATCCAATCAGGGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147267    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178557.2-1954s1c1
Sequence:CCGGGCAGGAGAAGAATAAACACTTCTCGAGAAGTGTTTATTCTTCTCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146484    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178557.2-1651s1c1
Sequence:CCGGCCTGATTGGATGTCATTTCCTCTCGAGAGGAAATGACATCCAATCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148647    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178557.2-1473s1c1
Sequence:CCGGCAGCCTGAAACCAACACATTTCTCGAGAAATGTGTTGGTTTCAGGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147770    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178557.2-1526s1c1
Sequence:CCGGGCATGACTTTAATTCTTGGGACTCGAGTCCCAAGAATTAAAGTCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178557.3-509s21c1
Sequence:CCGGCGGACATCGAGCAGTACTACACTCGAGTGTAGTACTGCTCGATGTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178557.3-1102s21c1
Sequence:CCGGGTGGGTTGTTTGTCGCCATAGCTCGAGCTATGGCGACAAACAACCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178557
NAT8L MISSION shRNA Lentiviral Transduction Particles
N-acetyltransferase 8-like (GCN5-related, putative)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149334    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178557.2-1646s1c1
Sequence:CCGGGAAACCCTGATTGGATGTCATCTCGAGATGACATCCAATCAGGGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147267    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178557.2-1954s1c1
Sequence:CCGGGCAGGAGAAGAATAAACACTTCTCGAGAAGTGTTTATTCTTCTCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146484    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178557.2-1651s1c1
Sequence:CCGGCCTGATTGGATGTCATTTCCTCTCGAGAGGAAATGACATCCAATCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148647    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178557.2-1473s1c1
Sequence:CCGGCAGCCTGAAACCAACACATTTCTCGAGAAATGTGTTGGTTTCAGGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147770    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178557.2-1526s1c1
Sequence:CCGGGCATGACTTTAATTCTTGGGACTCGAGTCCCAAGAATTAAAGTCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178557.3-509s21c1
Sequence:CCGGCGGACATCGAGCAGTACTACACTCGAGTGTAGTACTGCTCGATGTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178557.3-1102s21c1
Sequence:CCGGGTGGGTTGTTTGTCGCCATAGCTCGAGCTATGGCGACAAACAACCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001985
NAT8L MISSION shRNA Bacterial Glycerol Stock
N-acetyltransferase 8-like (GCN5-related, putative)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001985.1-697s1c1
Sequence:CCGGCCACAAGCTCTATGAGTCACTCTCGAGAGTGACTCATAGAGCTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001985.1-634s1c1
Sequence:CCGGGTTTGCCATGCTGCACAACTACTCGAGTAGTTGTGCAGCATGGCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001985.1-703s1c1
Sequence:CCGGGCTCTATGAGTCACTGGGCTTCTCGAGAAGCCCAGTGACTCATAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001985.1-667s1c1
Sequence:CCGGACTGGGCACCACAGCCGTTAACTCGAGTTAACGGCTGTGGTGCCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114581    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001985.1-931s1c1
Sequence:CCGGCCTTGGCATTTGTTTGGGTTTCTCGAGAAACCCAAACAAATGCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001985
NAT8L MISSION shRNA shRNA Plasmid DNA
N-acetyltransferase 8-like (GCN5-related, putative)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001985.1-697s1c1
Sequence:CCGGCCACAAGCTCTATGAGTCACTCTCGAGAGTGACTCATAGAGCTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001985.1-634s1c1
Sequence:CCGGGTTTGCCATGCTGCACAACTACTCGAGTAGTTGTGCAGCATGGCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001985.1-703s1c1
Sequence:CCGGGCTCTATGAGTCACTGGGCTTCTCGAGAAGCCCAGTGACTCATAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001985.1-667s1c1
Sequence:CCGGACTGGGCACCACAGCCGTTAACTCGAGTTAACGGCTGTGGTGCCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114581    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001985.1-931s1c1
Sequence:CCGGCCTTGGCATTTGTTTGGGTTTCTCGAGAAACCCAAACAAATGCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001985
NAT8L MISSION shRNA Lentiviral Transduction Particles
N-acetyltransferase 8-like (GCN5-related, putative)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001985.1-697s1c1
Sequence:CCGGCCACAAGCTCTATGAGTCACTCTCGAGAGTGACTCATAGAGCTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001985.1-634s1c1
Sequence:CCGGGTTTGCCATGCTGCACAACTACTCGAGTAGTTGTGCAGCATGGCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001985.1-703s1c1
Sequence:CCGGGCTCTATGAGTCACTGGGCTTCTCGAGAAGCCCAGTGACTCATAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001985.1-667s1c1
Sequence:CCGGACTGGGCACCACAGCCGTTAACTCGAGTTAACGGCTGTGGTGCCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114581    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001985.1-931s1c1
Sequence:CCGGCCTTGGCATTTGTTTGGGTTTCTCGAGAAACCCAAACAAATGCCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)