EMAIL THIS PAGE TO A FRIEND

NAT9

N-acetyltransferase 9 (GCN5-related, putative)

54 Gene Product Result for
Synonyms: EBSP, hNATL
UniProtKB ID: Q9BTE0, B2R7F0, Q9BTD0, Q9Y3T3
Gene ID:
Mouse(66176) N-acetyltransferase 9 (GCN5-related, putative)
Rat(303669) N-acetyltransferase 9 (GCN5-related, putative)
sheep(101103166) N-acetyltransferase 9 (GCN5-related, putative)
naked mole-rat(101696817) N-acetyltransferase 9 (GCN5-related, putative)
domestic guinea pig(100722236) N-acetyltransferase 9 (GCN5-related, putative)
Zebrafish(326898) N-acetyltransferase 9 (GCN5-related, putative)
chicken(422109) N-acetyltransferase 9 (GCN5-related, putative)
cow(514377) N-acetyltransferase 9 (GCN5-related, putative)
domestic cat(101091487) N-acetyltransferase 9 (GCN5-related, putative)
dog(483300) N-acetyltransferase 9 (GCN5-related, putative)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025400 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025400 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025400 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015654 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015654 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015654 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015654 Rosetta Predictions human pricing
NM_001134835 Rosetta Predictions rat pricing
NM_025400 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015654 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235536 predicted 1106
2 SASI_Hs01_00235537 predicted 519
3 SASI_Hs01_00235538 predicted 735
4 SASI_Hs01_00235539 predicted 558
5 SASI_Hs02_00348264 predicted 343
6 SASI_Hs01_00235540 predicted 251
7 SASI_Hs01_00235541 predicted 463
8 SASI_Hs01_00235542 predicted 324
9 SASI_Hs01_00235543 predicted 803
10 SASI_Hs01_00235545 predicted 246
11 SASI_Hs01_00235544 predicted 1014
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134835 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258634 predicted 886
2 SASI_Rn02_00258635 predicted 812
3 SASI_Rn02_00258636 predicted 826
4 SASI_Rn02_00258637 predicted 417
5 SASI_Rn02_00258638 predicted 898
6 SASI_Rn02_00258639 predicted 953
7 SASI_Rn02_00258640 predicted 1048
8 SASI_Rn02_00258641 predicted 875
9 SASI_Rn02_00258642 predicted 545
10 SASI_Rn02_00258643 predicted 572
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025400 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079659 predicted 601
2 SASI_Mm01_00079660 predicted 235
3 SASI_Mm01_00079661 predicted 754
4 SASI_Mm01_00079665 predicted 681
5 SASI_Mm01_00079662 predicted 616
6 SASI_Mm01_00079663 predicted 620
7 SASI_Mm02_00328152 predicted 693
8 SASI_Mm01_00079666 predicted 796
9 SASI_Mm01_00079667 predicted 658
10 SASI_Mm01_00079668 predicted 339
11 SASI_Mm01_00079664 predicted 696
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025400
NAT9 MISSION shRNA Bacterial Glycerol Stock
N-acetyltransferase 9 (GCN5-related, putative)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025400.3-596s21c1
Sequence:CCGGCCTACGGTGTGACGAAGTTAGCTCGAGCTAACTTCGTCACACCGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025400.2-675s1c1
Sequence:CCGGCCAGAAACTTCACTTTAAGCACTCGAGTGCTTAAAGTGAAGTTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025400.3-518s21c1
Sequence:CCGGGGGAGATCGAGGTCATGATTGCTCGAGCAATCATGACCTCGATCTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025400.3-344s21c1
Sequence:CCGGTGACCCTACAGCAGGAGTATGCTCGAGCATACTCCTGCTGTAGGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025400.3-672s21c1
Sequence:CCGGGTTCCAGAAACTTCACTTTAACTCGAGTTAAAGTGAAGTTTCTGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025400.2-391s1c1
Sequence:CCGGGAAGACAAGTGCACCTTCATTCTCGAGAATGAAGGTGCACTTGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025400.2-396s1c1
Sequence:CCGGCAAGTGCACCTTCATTGTGCTCTCGAGAGCACAATGAAGGTGCACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025400.3-953s21c1
Sequence:CCGGCCTGGTTAGCAGTGGTCAAGACTCGAGTCTTGACCACTGCTAACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025400
NAT9 MISSION shRNA shRNA Plasmid DNA
N-acetyltransferase 9 (GCN5-related, putative)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025400.3-596s21c1
Sequence:CCGGCCTACGGTGTGACGAAGTTAGCTCGAGCTAACTTCGTCACACCGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025400.2-675s1c1
Sequence:CCGGCCAGAAACTTCACTTTAAGCACTCGAGTGCTTAAAGTGAAGTTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025400.3-518s21c1
Sequence:CCGGGGGAGATCGAGGTCATGATTGCTCGAGCAATCATGACCTCGATCTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025400.3-344s21c1
Sequence:CCGGTGACCCTACAGCAGGAGTATGCTCGAGCATACTCCTGCTGTAGGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025400.3-672s21c1
Sequence:CCGGGTTCCAGAAACTTCACTTTAACTCGAGTTAAAGTGAAGTTTCTGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025400.2-391s1c1
Sequence:CCGGGAAGACAAGTGCACCTTCATTCTCGAGAATGAAGGTGCACTTGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025400.2-396s1c1
Sequence:CCGGCAAGTGCACCTTCATTGTGCTCTCGAGAGCACAATGAAGGTGCACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025400.3-953s21c1
Sequence:CCGGCCTGGTTAGCAGTGGTCAAGACTCGAGTCTTGACCACTGCTAACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025400
NAT9 MISSION shRNA Lentiviral Transduction Particles
N-acetyltransferase 9 (GCN5-related, putative)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025400.3-596s21c1
Sequence:CCGGCCTACGGTGTGACGAAGTTAGCTCGAGCTAACTTCGTCACACCGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025400.2-675s1c1
Sequence:CCGGCCAGAAACTTCACTTTAAGCACTCGAGTGCTTAAAGTGAAGTTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025400.3-518s21c1
Sequence:CCGGGGGAGATCGAGGTCATGATTGCTCGAGCAATCATGACCTCGATCTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025400.3-344s21c1
Sequence:CCGGTGACCCTACAGCAGGAGTATGCTCGAGCATACTCCTGCTGTAGGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025400.3-672s21c1
Sequence:CCGGGTTCCAGAAACTTCACTTTAACTCGAGTTAAAGTGAAGTTTCTGGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025400.2-391s1c1
Sequence:CCGGGAAGACAAGTGCACCTTCATTCTCGAGAATGAAGGTGCACTTGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025400.2-396s1c1
Sequence:CCGGCAAGTGCACCTTCATTGTGCTCTCGAGAGCACAATGAAGGTGCACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025400.3-953s21c1
Sequence:CCGGCCTGGTTAGCAGTGGTCAAGACTCGAGTCTTGACCACTGCTAACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015654
VALIDATED
NAT9 MISSION shRNA Bacterial Glycerol Stock
N-acetyltransferase 9 (GCN5-related, putative)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_015654.3-536s1c1
Sequence:CCGGGATGTTCCAGAAACTTCACTTCTCGAGAAGTGAAGTTTCTGGAACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167236    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015654.3-1748s1c1
Sequence:CCGGCTTAGATAAGTAAGGTGACTTCTCGAGAAGTCACCTTACTTATCTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000220049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015654.3-385s1c1
Sequence:CCGGGGGAGATCGAGGTCATGATTGCTCGAGCAATCATGACCTCGATCTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015654.3-447s21c1
Sequence:CCGGGTTCTCGCGATGCTGTCTTACCTCGAGGTAAGACAGCATCGCGAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000220050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_015654.3-478s1c1
Sequence:CCGGCGCTAGGTCTGACCAAGTTTGCTCGAGCAAACTTGGTCAGACCTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015654.3-340s1c1
Sequence:CCGGGAGATGTGAACCTCTTCCTCACTCGAGTGAGGAAGAGGTTCACATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015654.3-259s21c1
Sequence:CCGGCAGACAAGTGTACCTTCATTGCTCGAGCAATGAAGGTACACTTGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015654.3-608s21c1
Sequence:CCGGAGTGAGTGAGTCCGAGCATCACTCGAGTGATGCTCGGACTCACTCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015654
VALIDATED
NAT9 MISSION shRNA shRNA Plasmid DNA
N-acetyltransferase 9 (GCN5-related, putative)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_015654.3-536s1c1
Sequence:CCGGGATGTTCCAGAAACTTCACTTCTCGAGAAGTGAAGTTTCTGGAACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167236    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015654.3-1748s1c1
Sequence:CCGGCTTAGATAAGTAAGGTGACTTCTCGAGAAGTCACCTTACTTATCTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000220049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015654.3-385s1c1
Sequence:CCGGGGGAGATCGAGGTCATGATTGCTCGAGCAATCATGACCTCGATCTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015654.3-447s21c1
Sequence:CCGGGTTCTCGCGATGCTGTCTTACCTCGAGGTAAGACAGCATCGCGAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000220050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_015654.3-478s1c1
Sequence:CCGGCGCTAGGTCTGACCAAGTTTGCTCGAGCAAACTTGGTCAGACCTAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015654.3-340s1c1
Sequence:CCGGGAGATGTGAACCTCTTCCTCACTCGAGTGAGGAAGAGGTTCACATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015654.3-259s21c1
Sequence:CCGGCAGACAAGTGTACCTTCATTGCTCGAGCAATGAAGGTACACTTGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015654.3-608s21c1
Sequence:CCGGAGTGAGTGAGTCCGAGCATCACTCGAGTGATGCTCGGACTCACTCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015654
VALIDATED
NAT9 MISSION shRNA Lentiviral Transduction Particles
N-acetyltransferase 9 (GCN5-related, putative)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_015654.3-536s1c1
Sequence:CCGGGATGTTCCAGAAACTTCACTTCTCGAGAAGTGAAGTTTCTGGAACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167236    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015654.3-1748s1c1
Sequence:CCGGCTTAGATAAGTAAGGTGACTTCTCGAGAAGTCACCTTACTTATCTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000220049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015654.3-385s1c1
Sequence:CCGGGGGAGATCGAGGTCATGATTGCTCGAGCAATCATGACCTCGATCTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015654.3-447s21c1
Sequence:CCGGGTTCTCGCGATGCTGTCTTACCTCGAGGTAAGACAGCATCGCGAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000220050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_015654.3-478s1c1
Sequence:CCGGCGCTAGGTCTGACCAAGTTTGCTCGAGCAAACTTGGTCAGACCTAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015654.3-340s1c1
Sequence:CCGGGAGATGTGAACCTCTTCCTCACTCGAGTGAGGAAGAGGTTCACATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015654.3-259s21c1
Sequence:CCGGCAGACAAGTGTACCTTCATTGCTCGAGCAATGAAGGTACACTTGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015654.3-608s21c1
Sequence:CCGGAGTGAGTGAGTCCGAGCATCACTCGAGTGATGCTCGGACTCACTCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)