EMAIL THIS PAGE TO A FRIEND

NAV1

neuron navigator 1

322 Gene Product Result for
Synonyms: POMFIL3 STEERIN1 UNC53H1
Gene ID:
Human(89796) Summary: This gene belongs to the neuron navigator family and is expressed predominantly in the nervous system. The encoded protein contains coiled-coil domains and a conserved AAA domain characteristic for ATPases associated with a variety of cellular activities. This gene is similar to unc-53, a Caenorhabditis elegans gene involved in axon guidance. The exact function of this gene is not known, but it is thought to play a role in in neuronal development and regeneration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2009]
Mouse(215690) neuron navigator 1
Rat(304818) neuron navigator 1
Zebrafish(100536287) neuron navigator 1
chicken(430162) neuron navigator 1
cow(531974) neuron navigator 1
domestic cat(101096869) neuron navigator 1
dog(490238) neuron navigator 1
domestic guinea pig(100732683) neuron navigator 1
naked mole-rat(101719454) neuron navigator 1
sheep(101112917) neuron navigator 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020443 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020443 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020443 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173437 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173437 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173437 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020443 Rosetta Predictions human pricing
XM_001063421 Rosetta Predictions rat pricing
XM_222662 Rosetta Predictions rat pricing
NM_173437 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020443 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139710 predicted 2532
2 SASI_Hs01_00139711 predicted 1207
3 SASI_Hs02_00353467 predicted 4867
4 SASI_Hs02_00353468 predicted 5502
5 SASI_Hs01_00139713 predicted 5630
6 SASI_Hs01_00139714 predicted 1568
7 SASI_Hs01_00139715 predicted 2770
8 SASI_Hs01_00139717 predicted 3168
9 SASI_Hs01_00139718 predicted 3364
10 SASI_Hs02_00353469 predicted 4394
11 SASI_Hs01_00139709 predicted 2925
12 SASI_Hs01_00139712 predicted 5911
13 SASI_Hs01_00139716 predicted 2485
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063421 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00307069 predicted 3693
2 SASI_Rn02_00307070 predicted 2316
3 SASI_Rn02_00307071 predicted 4631
4 SASI_Rn02_00307072 predicted 786
5 SASI_Rn02_00307073 predicted 3714
6 SASI_Rn02_00307074 predicted 3158
7 SASI_Rn02_00307075 predicted 3193
8 SASI_Rn02_00307076 predicted 2764
9 SASI_Rn02_00307077 predicted 2380
10 SASI_Rn02_00307078 predicted 4082
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_222662 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00127091 predicted 6369
2 SASI_Rn01_00127092 predicted 6419
3 SASI_Rn01_00127093 predicted 2023
4 SASI_Rn01_00127094 predicted 2029
5 SASI_Rn01_00127095 predicted 2863
6 SASI_Rn01_00127096 predicted 7802
7 SASI_Rn01_00127097 predicted 7262
8 SASI_Rn01_00127098 predicted 8720
9 SASI_Rn01_00127099 predicted 3153
10 SASI_Rn01_00127100 predicted 6481
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173437 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136913 predicted 2793
2 SASI_Mm01_00136914 predicted 2591
3 SASI_Mm01_00136916 predicted 2527
4 SASI_Mm02_00345326 predicted 2649
5 SASI_Mm01_00136918 predicted 3403
6 SASI_Mm01_00136919 predicted 715
7 SASI_Mm01_00136920 predicted 4339
8 SASI_Mm01_00136921 predicted 4842
9 SASI_Mm01_00136922 predicted 3854
10 SASI_Mm02_00345327 predicted 2357
11 SASI_Mm01_00136915 predicted 2121
12 SASI_Mm01_00136917 predicted 3926
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020443
NAV1 MISSION shRNA Bacterial Glycerol Stock
neuron navigator 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148860    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020443.2-10780s1c1
Sequence:CCGGCCCTGGTTTCTCATTCCTTAACTCGAGTTAAGGAATGAGAAACCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128104    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020443.2-9996s1c1
Sequence:CCGGCCACATAGAAACCCTGCATTTCTCGAGAAATGCAGGGTTTCTATGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020443.2-2280s1c1
Sequence:CCGGCGCAAGACTAGCTTAGATGTTCTCGAGAACATCTAAGCTAGTCTTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020443.2-4038s1c1
Sequence:CCGGGCTTCCTCATACTCGGATATACTCGAGTATATCCGAGTATGAGGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020443.4-4010s21c1
Sequence:CCGGCAACAAAGCGTTCAGTATAAACTCGAGTTTATACTGAACGCTTTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147229    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020443.2-10233s1c1
Sequence:CCGGGCACTGACTAAGCTAAAGTTACTCGAGTAACTTTAGCTTAGTCAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020443.4-1689s21c1
Sequence:CCGGTCTCGCAGGAACTCAACAATACTCGAGTATTGTTGAGTTCCTGCGAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020443.2-3998s1c1
Sequence:CCGGCTTCAACAAAGCGTTCAGTATCTCGAGATACTGAACGCTTTGTTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020443.2-5621s1c1
Sequence:CCGGCCTGTGGAACAACTCTATCATCTCGAGATGATAGAGTTGTTCCACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020443
NAV1 MISSION shRNA shRNA Plasmid DNA
neuron navigator 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148860    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020443.2-10780s1c1
Sequence:CCGGCCCTGGTTTCTCATTCCTTAACTCGAGTTAAGGAATGAGAAACCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128104    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020443.2-9996s1c1
Sequence:CCGGCCACATAGAAACCCTGCATTTCTCGAGAAATGCAGGGTTTCTATGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020443.2-2280s1c1
Sequence:CCGGCGCAAGACTAGCTTAGATGTTCTCGAGAACATCTAAGCTAGTCTTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020443.2-4038s1c1
Sequence:CCGGGCTTCCTCATACTCGGATATACTCGAGTATATCCGAGTATGAGGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020443.4-4010s21c1
Sequence:CCGGCAACAAAGCGTTCAGTATAAACTCGAGTTTATACTGAACGCTTTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147229    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020443.2-10233s1c1
Sequence:CCGGGCACTGACTAAGCTAAAGTTACTCGAGTAACTTTAGCTTAGTCAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020443.4-1689s21c1
Sequence:CCGGTCTCGCAGGAACTCAACAATACTCGAGTATTGTTGAGTTCCTGCGAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020443.2-3998s1c1
Sequence:CCGGCTTCAACAAAGCGTTCAGTATCTCGAGATACTGAACGCTTTGTTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020443.2-5621s1c1
Sequence:CCGGCCTGTGGAACAACTCTATCATCTCGAGATGATAGAGTTGTTCCACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020443
NAV1 MISSION shRNA Lentiviral Transduction Particles
neuron navigator 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148860    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020443.2-10780s1c1
Sequence:CCGGCCCTGGTTTCTCATTCCTTAACTCGAGTTAAGGAATGAGAAACCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128104    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020443.2-9996s1c1
Sequence:CCGGCCACATAGAAACCCTGCATTTCTCGAGAAATGCAGGGTTTCTATGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020443.2-2280s1c1
Sequence:CCGGCGCAAGACTAGCTTAGATGTTCTCGAGAACATCTAAGCTAGTCTTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020443.2-4038s1c1
Sequence:CCGGGCTTCCTCATACTCGGATATACTCGAGTATATCCGAGTATGAGGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020443.4-4010s21c1
Sequence:CCGGCAACAAAGCGTTCAGTATAAACTCGAGTTTATACTGAACGCTTTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147229    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020443.2-10233s1c1
Sequence:CCGGGCACTGACTAAGCTAAAGTTACTCGAGTAACTTTAGCTTAGTCAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020443.4-1689s21c1
Sequence:CCGGTCTCGCAGGAACTCAACAATACTCGAGTATTGTTGAGTTCCTGCGAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020443.2-3998s1c1
Sequence:CCGGCTTCAACAAAGCGTTCAGTATCTCGAGATACTGAACGCTTTGTTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020443.2-5621s1c1
Sequence:CCGGCCTGTGGAACAACTCTATCATCTCGAGATGATAGAGTTGTTCCACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173437
NAV1 MISSION shRNA Bacterial Glycerol Stock
neuron navigator 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173437.1-5672s1c1
Sequence:CCGGCCTGTGGAACAATTCCATCATCTCGAGATGATGGAATTGTTCCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125409    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173437.1-6349s1c1
Sequence:CCGGCGGAAGATATAAACAGACAAACTCGAGTTTGTCTGTTTATATCTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173437.1-2975s1c1
Sequence:CCGGCCTGGAGCTAATGAGTGGTTTCTCGAGAAACCACTCATTAGCTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173437.1-4915s1c1
Sequence:CCGGGCCGAGGTGTCAATAACATATCTCGAGATATGTTATTGACACCTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173437.1-979s1c1
Sequence:CCGGCGGTAAGCGATGATGGCAAATCTCGAGATTTGCCATCATCGCTTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173437
NAV1 MISSION shRNA shRNA Plasmid DNA
neuron navigator 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173437.1-5672s1c1
Sequence:CCGGCCTGTGGAACAATTCCATCATCTCGAGATGATGGAATTGTTCCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125409    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173437.1-6349s1c1
Sequence:CCGGCGGAAGATATAAACAGACAAACTCGAGTTTGTCTGTTTATATCTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173437.1-2975s1c1
Sequence:CCGGCCTGGAGCTAATGAGTGGTTTCTCGAGAAACCACTCATTAGCTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173437.1-4915s1c1
Sequence:CCGGGCCGAGGTGTCAATAACATATCTCGAGATATGTTATTGACACCTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173437.1-979s1c1
Sequence:CCGGCGGTAAGCGATGATGGCAAATCTCGAGATTTGCCATCATCGCTTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173437
NAV1 MISSION shRNA Lentiviral Transduction Particles
neuron navigator 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173437.1-5672s1c1
Sequence:CCGGCCTGTGGAACAATTCCATCATCTCGAGATGATGGAATTGTTCCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125409    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173437.1-6349s1c1
Sequence:CCGGCGGAAGATATAAACAGACAAACTCGAGTTTGTCTGTTTATATCTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173437.1-2975s1c1
Sequence:CCGGCCTGGAGCTAATGAGTGGTTTCTCGAGAAACCACTCATTAGCTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173437.1-4915s1c1
Sequence:CCGGGCCGAGGTGTCAATAACATATCTCGAGATATGTTATTGACACCTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173437.1-979s1c1
Sequence:CCGGCGGTAAGCGATGATGGCAAATCTCGAGATTTGCCATCATCGCTTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)