EMAIL THIS PAGE TO A FRIEND

NAV2

neuron navigator 2

243 Gene Product Result for
Synonyms: HELAD1 POMFIL2 RAINB1 STEERIN2 UNC53H2
Gene ID:
Human(89797) Summary: This gene encodes a member of the neuron navigator gene family, which may play a role in cellular growth and migration. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Mouse(78286) neuron navigator 2
Rat(171563) neuron navigator 2
sheep(101115490) neuron navigator 2
naked mole-rat(101723248) neuron navigator 2
Domestic Rabbit(100352991) neuron navigator 2
domestic guinea pig(100726158) neuron navigator 2
Zebrafish(100333160) neuron navigator 2
dog(485411) neuron navigator 2
chicken(422977) neuron navigator 2
domestic cat(101082943) neuron navigator 2
cow(100139508) neuron navigator 2
Horse(100071978) neuron navigator 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175272 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175272 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175272 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145117 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145117 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145117 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU082801 MISSION® esiRNA esiRNA human NAV2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001111018 Rosetta Predictions human pricing
NM_001111019 Rosetta Predictions human pricing
NM_145117 Rosetta Predictions human pricing
NM_182964 Rosetta Predictions human pricing
XM_001080281 Rosetta Predictions rat pricing
XM_001080288 Rosetta Predictions rat pricing
XM_341864 Rosetta Predictions rat pricing
NM_001111016 Rosetta Predictions mouse pricing
NM_175272 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111018 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325066 predicted 3059
2 SASI_Hs02_00325067 predicted 5104
3 SASI_Hs02_00325068 predicted 5983
4 SASI_Hs02_00325069 predicted 7089
5 SASI_Hs02_00325070 predicted 5602
6 SASI_Hs02_00325071 predicted 5711
7 SASI_Hs02_00325072 predicted 6771
8 SASI_Hs02_00325073 predicted 5702
9 SASI_Hs02_00325074 predicted 5944
10 SASI_Hs02_00325075 predicted 6844
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111019 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325076 predicted 295
2 SASI_Hs02_00325077 predicted 2282
3 SASI_Hs02_00325078 predicted 3162
4 SASI_Hs02_00325079 predicted 4264
5 SASI_Hs02_00325080 predicted 2766
6 SASI_Hs02_00325081 predicted 2884
7 SASI_Hs02_00325082 predicted 3944
8 SASI_Hs02_00325083 predicted 2877
9 SASI_Hs02_00325084 predicted 3118
10 SASI_Hs02_00325085 predicted 4022
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145117 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364999 predicted 3382
2 SASI_Hs02_00365000 predicted 5433
3 SASI_Hs01_00200117 predicted 6309
4 SASI_Hs02_00365001 predicted 7417
5 SASI_Hs01_00200119 predicted 5918
6 SASI_Hs02_00365002 predicted 6034
7 SASI_Hs02_00365003 predicted 7095
8 SASI_Hs02_00365004 predicted 6032
9 SASI_Hs02_00365005 predicted 6272
10 SASI_Hs01_00200124 predicted 7169
11 SASI_Hs01_00200116 predicted 2543
12 SASI_Hs01_00200118 predicted 2380
13 SASI_Hs01_00200120 predicted 2626
14 SASI_Hs01_00200121 predicted 4927
15 SASI_Hs01_00200122 predicted 5915
16 SASI_Hs01_00200123 predicted 2590
17 SASI_Hs01_00200125 predicted 6322
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182964 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371107 predicted 3382
2 SASI_Hs02_00371108 predicted 5434
3 SASI_Hs01_00060165 predicted 6321
4 SASI_Hs02_00371109 predicted 7425
5 SASI_Hs01_00060167 predicted 5928
6 SASI_Hs02_00371110 predicted 6043
7 SASI_Hs02_00371111 predicted 7107
8 SASI_Hs02_00371112 predicted 6040
9 SASI_Hs02_00371113 predicted 6281
10 SASI_Hs01_00060172 predicted 7181
11 SASI_Hs01_00060164 predicted 2609
12 SASI_Hs01_00060166 predicted 2449
13 SASI_Hs01_00060168 predicted 2698
14 SASI_Hs01_00060169 predicted 4994
15 SASI_Hs01_00060170 predicted 6095
16 SASI_Hs01_00060171 predicted 2659
17 SASI_Hs01_00060173 predicted 6502
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080281 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00367427 predicted 4276
2 SASI_Rn02_00367428 predicted 6737
3 SASI_Rn02_00367429 predicted 5025
4 SASI_Rn02_00367430 predicted 909
5 SASI_Rn02_00367431 predicted 2255
6 SASI_Rn02_00367432 predicted 1675
7 SASI_Rn02_00367433 predicted 5958
8 SASI_Rn02_00367434 predicted 1453
9 SASI_Rn02_00367435 predicted 2710
10 SASI_Rn02_00367436 predicted 2696
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080288 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00367449 predicted 4200
2 SASI_Rn02_00367450 predicted 6553
3 SASI_Rn02_00367451 predicted 4859
4 SASI_Rn02_00367452 predicted 836
5 SASI_Rn02_00367453 predicted 2189
6 SASI_Rn02_00367454 predicted 1609
7 SASI_Rn02_00367455 predicted 5779
8 SASI_Rn02_00367456 predicted 1384
9 SASI_Rn02_00367457 predicted 2636
10 SASI_Rn02_00367458 predicted 2628
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341864 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393503 predicted 4209
2 SASI_Rn02_00393504 predicted 6556
3 SASI_Rn02_00393505 predicted 4851
4 SASI_Rn02_00393506 predicted 833
5 SASI_Rn02_00393507 predicted 2189
6 SASI_Rn02_00393508 predicted 1609
7 SASI_Rn02_00393509 predicted 5784
8 SASI_Rn02_00393510 predicted 1376
9 SASI_Rn02_00393511 predicted 2638
10 SASI_Rn02_00393512 predicted 2626
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111016 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306048 predicted 5557
2 SASI_Mm02_00306049 predicted 2757
3 SASI_Mm02_00306050 predicted 7713
4 SASI_Mm02_00306051 predicted 6653
5 SASI_Mm02_00306052 predicted 3114
6 SASI_Mm02_00306053 predicted 5096
7 SASI_Mm02_00306054 predicted 1356
8 SASI_Mm02_00306055 predicted 6297
9 SASI_Mm02_00306056 predicted 6665
10 SASI_Mm02_00306057 predicted 3471
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175272 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345987 predicted 5811
2 SASI_Mm02_00345988 predicted 3018
3 SASI_Mm02_00345989 predicted 7969
4 SASI_Mm02_00345990 predicted 6913
5 SASI_Mm02_00345991 predicted 3370
6 SASI_Mm02_00345992 predicted 5363
7 SASI_Mm02_00345993 predicted 1619
8 SASI_Mm02_00345994 predicted 6551
9 SASI_Mm02_00345995 predicted 6934
10 SASI_Mm02_00345996 predicted 3727
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175272
VALIDATED
NAV2 MISSION shRNA Bacterial Glycerol Stock
neuron navigator 2
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175272.3-3488s21c1
Sequence:CCGGAGAGACCCTACAACGAAATACCTCGAGGTATTTCGTTGTAGGGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175272.3-6291s21c1
Sequence:CCGGACGGTCATGCAGTTACGAAATCTCGAGATTTCGTAACTGCATGACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175272.3-1619s21c1
Sequence:CCGGGAGCTTTAACAACTACGACAACTCGAGTTGTCGTAGTTGTTAAAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175272.3-3398s21c1
Sequence:CCGGTGACATCACTAGCGGGTATATCTCGAGATATACCCGCTAGTGATGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175272.3-2930s21c1
Sequence:CCGGTCGGCGACTTCGGACAGTAAACTCGAGTTTACTGTCCGAAGTCGCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175272.3-1027s21c1
Sequence:CCGGCCAATCATTACCTCGCTAAATCTCGAGATTTAGCGAGGTAATGATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175272.2-904s1c1
Sequence:CCGGGAGCTTTAACAACTACGACAACTCGAGTTGTCGTAGTTGTTAAAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175272.2-1462s1c1
Sequence:CCGGCAGGGCGCTTACCAATAAGAACTCGAGTTCTTATTGGTAAGCGCCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175272.2-959s1c1
Sequence:CCGGCCACCAAGTAACCATGAGAAACTCGAGTTTCTCATGGTTACTTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175272.2-1225s1c1
Sequence:CCGGCCCTAACAATCAGAAATCCATCTCGAGATGGATTTCTGATTGTTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108665    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175272.2-2392s1c1
Sequence:CCGGGCACTTTCTAAGTCTGGCAATCTCGAGATTGCCAGACTTAGAAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175272
VALIDATED
NAV2 MISSION shRNA shRNA Plasmid DNA
neuron navigator 2
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175272.3-3488s21c1
Sequence:CCGGAGAGACCCTACAACGAAATACCTCGAGGTATTTCGTTGTAGGGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175272.3-6291s21c1
Sequence:CCGGACGGTCATGCAGTTACGAAATCTCGAGATTTCGTAACTGCATGACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175272.3-1619s21c1
Sequence:CCGGGAGCTTTAACAACTACGACAACTCGAGTTGTCGTAGTTGTTAAAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175272.3-3398s21c1
Sequence:CCGGTGACATCACTAGCGGGTATATCTCGAGATATACCCGCTAGTGATGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175272.3-2930s21c1
Sequence:CCGGTCGGCGACTTCGGACAGTAAACTCGAGTTTACTGTCCGAAGTCGCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175272.3-1027s21c1
Sequence:CCGGCCAATCATTACCTCGCTAAATCTCGAGATTTAGCGAGGTAATGATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175272.2-904s1c1
Sequence:CCGGGAGCTTTAACAACTACGACAACTCGAGTTGTCGTAGTTGTTAAAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175272.2-1462s1c1
Sequence:CCGGCAGGGCGCTTACCAATAAGAACTCGAGTTCTTATTGGTAAGCGCCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175272.2-959s1c1
Sequence:CCGGCCACCAAGTAACCATGAGAAACTCGAGTTTCTCATGGTTACTTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175272.2-1225s1c1
Sequence:CCGGCCCTAACAATCAGAAATCCATCTCGAGATGGATTTCTGATTGTTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108665    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175272.2-2392s1c1
Sequence:CCGGGCACTTTCTAAGTCTGGCAATCTCGAGATTGCCAGACTTAGAAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175272
VALIDATED
NAV2 MISSION shRNA Lentiviral Transduction Particles
neuron navigator 2
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175272.3-3488s21c1
Sequence:CCGGAGAGACCCTACAACGAAATACCTCGAGGTATTTCGTTGTAGGGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175272.3-6291s21c1
Sequence:CCGGACGGTCATGCAGTTACGAAATCTCGAGATTTCGTAACTGCATGACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175272.3-1619s21c1
Sequence:CCGGGAGCTTTAACAACTACGACAACTCGAGTTGTCGTAGTTGTTAAAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175272.3-3398s21c1
Sequence:CCGGTGACATCACTAGCGGGTATATCTCGAGATATACCCGCTAGTGATGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175272.3-2930s21c1
Sequence:CCGGTCGGCGACTTCGGACAGTAAACTCGAGTTTACTGTCCGAAGTCGCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175272.3-1027s21c1
Sequence:CCGGCCAATCATTACCTCGCTAAATCTCGAGATTTAGCGAGGTAATGATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175272.2-904s1c1
Sequence:CCGGGAGCTTTAACAACTACGACAACTCGAGTTGTCGTAGTTGTTAAAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175272.2-1462s1c1
Sequence:CCGGCAGGGCGCTTACCAATAAGAACTCGAGTTCTTATTGGTAAGCGCCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175272.2-959s1c1
Sequence:CCGGCCACCAAGTAACCATGAGAAACTCGAGTTTCTCATGGTTACTTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175272.2-1225s1c1
Sequence:CCGGCCCTAACAATCAGAAATCCATCTCGAGATGGATTTCTGATTGTTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108665    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175272.2-2392s1c1
Sequence:CCGGGCACTTTCTAAGTCTGGCAATCTCGAGATTGCCAGACTTAGAAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145117
VALIDATED
NAV2 MISSION shRNA Bacterial Glycerol Stock
neuron navigator 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000336790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_145117.4-3996s21c1
Sequence:CCGGGCAGCATAGATTCCAACATTACTCGAGTAATGTTGGAATCTATGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145117.4-6933s21c1
Sequence:CCGGGCCCTTACATAATTGGCACAACTCGAGTTGTGCCAATTATGTAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145117.4-4804s21c1
Sequence:CCGGGCACCTTGATAGGAACACTTTCTCGAGAAAGTGTTCCTATCAAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_145117.4-2979s21c1
Sequence:CCGGACATCCGGACCGATGACATTACTCGAGTAATGTCATCGGTCCGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_145117.2-5464s1c1
Sequence:CCGGGCTGCCATTAATGGAGTAATTCTCGAGAATTACTCCATTAATGGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145117.2-3965s1c1
Sequence:CCGGGCAGCATAGATTCCAACATTACTCGAGTAATGTTGGAATCTATGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145117.2-4773s1c1
Sequence:CCGGGCACCTTGATAGGAACACTTTCTCGAGAAAGTGTTCCTATCAAGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145117.2-6902s1c1
Sequence:CCGGGCCCTTACATAATTGGCACAACTCGAGTTGTGCCAATTATGTAAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145117.2-613s1c1
Sequence:CCGGGCCAATCATTACCTAGCCAAACTCGAGTTTGGCTAGGTAATGATTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145117
VALIDATED
NAV2 MISSION shRNA shRNA Plasmid DNA
neuron navigator 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000336790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_145117.4-3996s21c1
Sequence:CCGGGCAGCATAGATTCCAACATTACTCGAGTAATGTTGGAATCTATGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145117.4-6933s21c1
Sequence:CCGGGCCCTTACATAATTGGCACAACTCGAGTTGTGCCAATTATGTAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145117.4-4804s21c1
Sequence:CCGGGCACCTTGATAGGAACACTTTCTCGAGAAAGTGTTCCTATCAAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_145117.4-2979s21c1
Sequence:CCGGACATCCGGACCGATGACATTACTCGAGTAATGTCATCGGTCCGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_145117.2-5464s1c1
Sequence:CCGGGCTGCCATTAATGGAGTAATTCTCGAGAATTACTCCATTAATGGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145117.2-3965s1c1
Sequence:CCGGGCAGCATAGATTCCAACATTACTCGAGTAATGTTGGAATCTATGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145117.2-4773s1c1
Sequence:CCGGGCACCTTGATAGGAACACTTTCTCGAGAAAGTGTTCCTATCAAGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145117.2-6902s1c1
Sequence:CCGGGCCCTTACATAATTGGCACAACTCGAGTTGTGCCAATTATGTAAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145117.2-613s1c1
Sequence:CCGGGCCAATCATTACCTAGCCAAACTCGAGTTTGGCTAGGTAATGATTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145117
VALIDATED
NAV2 MISSION shRNA Lentiviral Transduction Particles
neuron navigator 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000336790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_145117.4-3996s21c1
Sequence:CCGGGCAGCATAGATTCCAACATTACTCGAGTAATGTTGGAATCTATGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145117.4-6933s21c1
Sequence:CCGGGCCCTTACATAATTGGCACAACTCGAGTTGTGCCAATTATGTAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145117.4-4804s21c1
Sequence:CCGGGCACCTTGATAGGAACACTTTCTCGAGAAAGTGTTCCTATCAAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_145117.4-2979s21c1
Sequence:CCGGACATCCGGACCGATGACATTACTCGAGTAATGTCATCGGTCCGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_145117.2-5464s1c1
Sequence:CCGGGCTGCCATTAATGGAGTAATTCTCGAGAATTACTCCATTAATGGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145117.2-3965s1c1
Sequence:CCGGGCAGCATAGATTCCAACATTACTCGAGTAATGTTGGAATCTATGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145117.2-4773s1c1
Sequence:CCGGGCACCTTGATAGGAACACTTTCTCGAGAAAGTGTTCCTATCAAGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145117.2-6902s1c1
Sequence:CCGGGCCCTTACATAATTGGCACAACTCGAGTTGTGCCAATTATGTAAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145117.2-613s1c1
Sequence:CCGGGCCAATCATTACCTAGCCAAACTCGAGTTTGGCTAGGTAATGATTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)