EMAIL THIS PAGE TO A FRIEND

NAV3

neuron navigator 3

239 Gene Product Result for
Synonyms: POMFIL1 STEERIN3 unc53H3
UniProtKB ID: Q8IVL0, Q8NFW7, Q9Y2E7
Gene ID:
Human(89795) Summary: This gene belongs to the neuron navigator family and is expressed predominantly in the nervous system. The encoded protein contains coiled-coil domains and a conserved AAA domain characteristic for ATPases associated with a variety of cellular activities. This gene is similar to unc-53, a Caenorhabditis elegans gene involved in axon guidance. Multiple alternatively spliced transcript variants for this gene have been described but only one has had its full-length nature determined. [provided by RefSeq, Jul 2008]
Mouse(260315) neuron navigator 3
Rat(314814) neuron navigator 3
Zebrafish(567779) neuron navigator 3
chicken(417869) neuron navigator 3
dog(482577) neuron navigator 3
domestic cat(101088856) neuron navigator 3
cow(528870) neuron navigator 3
Horse(100050448) neuron navigator 3
domestic guinea pig(100713036) neuron navigator 3
Domestic Rabbit(100349570) neuron navigator 3
naked mole-rat(101703345) neuron navigator 3
sheep(101102301) neuron navigator 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014903 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014903 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014903 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081035 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081035 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081035 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014903 Rosetta Predictions human pricing
XM_001078354 Rosetta Predictions rat pricing
XM_235115 Rosetta Predictions rat pricing
NM_001081035 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014903 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215078 predicted 964
2 SASI_Hs01_00215079 predicted 6864
3 SASI_Hs02_00346537 predicted 325
4 SASI_Hs01_00215081 predicted 6613
5 SASI_Hs01_00215082 predicted 6210
6 SASI_Hs02_00346538 predicted 231
7 SASI_Hs01_00215083 predicted 4114
8 SASI_Hs01_00215084 predicted 732
9 SASI_Hs01_00215085 predicted 2702
10 SASI_Hs01_00215086 predicted 5997
11 SASI_Hs01_00215077 predicted 2432
12 SASI_Hs01_00215080 predicted 2022
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078354 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00360514 predicted 6192
2 SASI_Rn02_00360515 predicted 5931
3 SASI_Rn02_00360516 predicted 4467
4 SASI_Rn02_00360517 predicted 4965
5 SASI_Rn02_00360518 predicted 4098
6 SASI_Rn02_00360519 predicted 1984
7 SASI_Rn02_00360520 predicted 2293
8 SASI_Rn02_00360521 predicted 5968
9 SASI_Rn02_00360522 predicted 4252
10 SASI_Rn02_00360523 predicted 6585
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235115 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389005 predicted 6188
2 SASI_Rn02_00389006 predicted 4463
3 SASI_Rn02_00389007 predicted 4099
4 SASI_Rn02_00389008 predicted 1975
5 SASI_Rn02_00389009 predicted 2290
6 SASI_Rn02_00389010 predicted 916
7 SASI_Rn02_00389011 predicted 5966
8 SASI_Rn02_00389012 predicted 4253
9 SASI_Rn02_00389013 predicted 6582
10 SASI_Rn02_00389014 predicted 4224
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081035 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294545 predicted 369
2 SASI_Mm02_00294546 predicted 5011
3 SASI_Mm02_00294547 predicted 5795
4 SASI_Mm02_00294548 predicted 2577
5 SASI_Mm02_00294549 predicted 3955
6 SASI_Mm02_00294550 predicted 3530
7 SASI_Mm02_00294551 predicted 4878
8 SASI_Mm02_00294552 predicted 6044
9 SASI_Mm02_00294553 predicted 2142
10 SASI_Mm02_00294554 predicted 5826
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014903
VALIDATED
NAV3 MISSION shRNA Bacterial Glycerol Stock
neuron navigator 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014903.3-5854s1c1
Sequence:CCGGCGTCTCTTTAAGGAATATGTACTCGAGTACATATTCCTTAAAGAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014903.4-6217s21c1
Sequence:CCGGCAATTACCCAAAGGTACTTTACTCGAGTAAAGTACCTTTGGGTAATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014903.4-8268s21c1
Sequence:CCGGGCCTTGTGAATAGATCGCTTTCTCGAGAAAGCGATCTATTCACAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014903.3-385s1c1
Sequence:CCGGGCAGAAATCATCCAGATTATTCTCGAGAATAATCTGGATGATTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107065    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_014903.3-8140s1c1
Sequence:CCGGGCCTTGTGAATAGATCGCTTTCTCGAGAAAGCGATCTATTCACAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014903.3-150s1c1
Sequence:CCGGGCACTGTTCTTCAAGACCTTTCTCGAGAAAGGTCTTGAAGAACAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014903.3-1731s1c1
Sequence:CCGGCCAGTCCTTATCTAAGCCTATCTCGAGATAGGCTTAGATAAGGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_014903.4-1859s21c1
Sequence:CCGGCCAGTCCTTATCTAAGCCTATCTCGAGATAGGCTTAGATAAGGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014903.4-513s21c1
Sequence:CCGGGCAGAAATCATCCAGATTATTCTCGAGAATAATCTGGATGATTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_014903.4-2615s21c1
Sequence:CCGGGGTCGATGTGGGTGGATATATCTCGAGATATATCCACCCACATCGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014903
VALIDATED
NAV3 MISSION shRNA shRNA Plasmid DNA
neuron navigator 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014903.3-5854s1c1
Sequence:CCGGCGTCTCTTTAAGGAATATGTACTCGAGTACATATTCCTTAAAGAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014903.4-6217s21c1
Sequence:CCGGCAATTACCCAAAGGTACTTTACTCGAGTAAAGTACCTTTGGGTAATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014903.4-8268s21c1
Sequence:CCGGGCCTTGTGAATAGATCGCTTTCTCGAGAAAGCGATCTATTCACAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014903.3-385s1c1
Sequence:CCGGGCAGAAATCATCCAGATTATTCTCGAGAATAATCTGGATGATTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107065    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_014903.3-8140s1c1
Sequence:CCGGGCCTTGTGAATAGATCGCTTTCTCGAGAAAGCGATCTATTCACAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014903.3-150s1c1
Sequence:CCGGGCACTGTTCTTCAAGACCTTTCTCGAGAAAGGTCTTGAAGAACAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014903.3-1731s1c1
Sequence:CCGGCCAGTCCTTATCTAAGCCTATCTCGAGATAGGCTTAGATAAGGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_014903.4-1859s21c1
Sequence:CCGGCCAGTCCTTATCTAAGCCTATCTCGAGATAGGCTTAGATAAGGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014903.4-513s21c1
Sequence:CCGGGCAGAAATCATCCAGATTATTCTCGAGAATAATCTGGATGATTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_014903.4-2615s21c1
Sequence:CCGGGGTCGATGTGGGTGGATATATCTCGAGATATATCCACCCACATCGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014903
VALIDATED
NAV3 MISSION shRNA Lentiviral Transduction Particles
neuron navigator 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014903.3-5854s1c1
Sequence:CCGGCGTCTCTTTAAGGAATATGTACTCGAGTACATATTCCTTAAAGAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014903.4-6217s21c1
Sequence:CCGGCAATTACCCAAAGGTACTTTACTCGAGTAAAGTACCTTTGGGTAATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014903.4-8268s21c1
Sequence:CCGGGCCTTGTGAATAGATCGCTTTCTCGAGAAAGCGATCTATTCACAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014903.3-385s1c1
Sequence:CCGGGCAGAAATCATCCAGATTATTCTCGAGAATAATCTGGATGATTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107065    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_014903.3-8140s1c1
Sequence:CCGGGCCTTGTGAATAGATCGCTTTCTCGAGAAAGCGATCTATTCACAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014903.3-150s1c1
Sequence:CCGGGCACTGTTCTTCAAGACCTTTCTCGAGAAAGGTCTTGAAGAACAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014903.3-1731s1c1
Sequence:CCGGCCAGTCCTTATCTAAGCCTATCTCGAGATAGGCTTAGATAAGGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_014903.4-1859s21c1
Sequence:CCGGCCAGTCCTTATCTAAGCCTATCTCGAGATAGGCTTAGATAAGGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014903.4-513s21c1
Sequence:CCGGGCAGAAATCATCCAGATTATTCTCGAGAATAATCTGGATGATTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_014903.4-2615s21c1
Sequence:CCGGGGTCGATGTGGGTGGATATATCTCGAGATATATCCACCCACATCGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081035
VALIDATED
NAV3 MISSION shRNA Bacterial Glycerol Stock
neuron navigator 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081035.1-6118s21c1
Sequence:CCGGGGGACGGGAAAGACCTATTTACTCGAGTAAATAGGTCTTTCCCGTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081035.1-897s21c1
Sequence:CCGGTCAACCATCTTCAGGTATAAACTCGAGTTTATACCTGAAGATGGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225860    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081035.1-7395s21c1
Sequence:CCGGATAGTGAGACTGGACTTTATTCTCGAGAATAAAGTCCAGTCTCACTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081035.1-6053s21c1
Sequence:GTACCGGCAATTACCCAAAGGTACTTTACTCGAGTAAAGTACCTTTGGGTAATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081035.1-2531s21c1
Sequence:CCGGATGGTGGGCTCAACCTATATACTCGAGTATATAGGTTGAGCCCACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081035
VALIDATED
NAV3 MISSION shRNA shRNA Plasmid DNA
neuron navigator 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081035.1-6118s21c1
Sequence:CCGGGGGACGGGAAAGACCTATTTACTCGAGTAAATAGGTCTTTCCCGTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081035.1-897s21c1
Sequence:CCGGTCAACCATCTTCAGGTATAAACTCGAGTTTATACCTGAAGATGGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225860    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081035.1-7395s21c1
Sequence:CCGGATAGTGAGACTGGACTTTATTCTCGAGAATAAAGTCCAGTCTCACTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081035.1-6053s21c1
Sequence:GTACCGGCAATTACCCAAAGGTACTTTACTCGAGTAAAGTACCTTTGGGTAATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081035.1-2531s21c1
Sequence:CCGGATGGTGGGCTCAACCTATATACTCGAGTATATAGGTTGAGCCCACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081035
VALIDATED
NAV3 MISSION shRNA Lentiviral Transduction Particles
neuron navigator 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081035.1-6118s21c1
Sequence:CCGGGGGACGGGAAAGACCTATTTACTCGAGTAAATAGGTCTTTCCCGTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081035.1-897s21c1
Sequence:CCGGTCAACCATCTTCAGGTATAAACTCGAGTTTATACCTGAAGATGGTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225860    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081035.1-7395s21c1
Sequence:CCGGATAGTGAGACTGGACTTTATTCTCGAGAATAAAGTCCAGTCTCACTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081035.1-6053s21c1
Sequence:GTACCGGCAATTACCCAAAGGTACTTTACTCGAGTAAAGTACCTTTGGGTAATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081035.1-2531s21c1
Sequence:CCGGATGGTGGGCTCAACCTATATACTCGAGTATATAGGTTGAGCCCACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)