EMAIL THIS PAGE TO A FRIEND

NBAS

neuroblastoma amplified sequence

22 Gene Product Result for
Synonyms: NAG SOPH
Gene ID:
Human(51594) Summary: This gene encodes a protein with two leucine zipper domains, a ribosomal protein S14 signature domain and a Sec39 like domain. The protein is thought to be involved in Golgi-to-ER transport. Mutations in this gene are associated with short stature, optic nerve atrophy, and Pelger-Huet anomaly. [provided by RefSeq, Oct 2012]
Mouse(71169) neuroblastoma amplified sequence
sheep(101105564) neuroblastoma amplified sequence
naked mole-rat(101704688) neuroblastoma amplified sequence
Domestic Rabbit(100346693) neuroblastoma amplified sequence
domestic guinea pig(101787846) neuroblastoma amplified sequence
Zebrafish(556592) neuroblastoma amplified sequence
domestic cat(101085115) neuroblastoma amplified sequence
cow(521982) neuroblastoma amplified sequence
dog(482975) neuroblastoma amplified sequence
chicken(421947) neuroblastoma amplified sequence
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA036817 Anti-NBAS antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027706 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027706 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027706 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015909 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015909 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015909 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015909 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015909 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227944 predicted 5291
2 SASI_Hs01_00227945 predicted 2439
3 SASI_Hs01_00227946 predicted 3036
4 SASI_Hs01_00227948 predicted 3014
5 SASI_Hs01_00227949 predicted 3309
6 SASI_Hs01_00227950 predicted 2545
7 SASI_Hs02_00348508 predicted 1572
8 SASI_Hs01_00227951 predicted 5861
9 SASI_Hs01_00227952 predicted 6945
10 SASI_Hs02_00348509 predicted 5987
11 SASI_Hs01_00227947 predicted 5257
12 SASI_Hs01_00227953 predicted 5559
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027706
VALIDATED
NBAS MISSION shRNA Bacterial Glycerol Stock
neuroblastoma amplified sequence
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027706.1-5728s21c1
Sequence:CCGGATGACCAGAAAGGCCATTAAGCTCGAGCTTAATGGCCTTTCTGGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027706.1-850s21c1
Sequence:CCGGCTTTCAGGCTCACCGTATTATCTCGAGATAATACGGTGAGCCTGAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027706.1-2317s21c1
Sequence:CCGGACCACCTCTCCACACGAATATCTCGAGATATTCGTGTGGAGAGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027706.1-3002s21c1
Sequence:CCGGTAGCGCTCGAATGCATCTATACTCGAGTATAGATGCATTCGAGCGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027706.1-2095s21c1
Sequence:CCGGTTAGATCGTCTTGCAACATATCTCGAGATATGTTGCAAGACGATCTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027706
VALIDATED
NBAS MISSION shRNA shRNA Plasmid DNA
neuroblastoma amplified sequence
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027706.1-5728s21c1
Sequence:CCGGATGACCAGAAAGGCCATTAAGCTCGAGCTTAATGGCCTTTCTGGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027706.1-850s21c1
Sequence:CCGGCTTTCAGGCTCACCGTATTATCTCGAGATAATACGGTGAGCCTGAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027706.1-2317s21c1
Sequence:CCGGACCACCTCTCCACACGAATATCTCGAGATATTCGTGTGGAGAGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027706.1-3002s21c1
Sequence:CCGGTAGCGCTCGAATGCATCTATACTCGAGTATAGATGCATTCGAGCGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027706.1-2095s21c1
Sequence:CCGGTTAGATCGTCTTGCAACATATCTCGAGATATGTTGCAAGACGATCTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027706
VALIDATED
NBAS MISSION shRNA Lentiviral Transduction Particles
neuroblastoma amplified sequence
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027706.1-5728s21c1
Sequence:CCGGATGACCAGAAAGGCCATTAAGCTCGAGCTTAATGGCCTTTCTGGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027706.1-850s21c1
Sequence:CCGGCTTTCAGGCTCACCGTATTATCTCGAGATAATACGGTGAGCCTGAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027706.1-2317s21c1
Sequence:CCGGACCACCTCTCCACACGAATATCTCGAGATATTCGTGTGGAGAGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027706.1-3002s21c1
Sequence:CCGGTAGCGCTCGAATGCATCTATACTCGAGTATAGATGCATTCGAGCGCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027706.1-2095s21c1
Sequence:CCGGTTAGATCGTCTTGCAACATATCTCGAGATATGTTGCAAGACGATCTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015909
VALIDATED
NBAS MISSION shRNA Bacterial Glycerol Stock
neuroblastoma amplified sequence
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015909.2-737s21c1
Sequence:CCGGTGGAATCAACACAGCTATTTACTCGAGTAAATAGCTGTGTTGATTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015909.2-2869s21c1
Sequence:CCGGGTGTGGCTAATGAGCTATTAACTCGAGTTAATAGCTCATTAGCCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015909.2-189s21c1
Sequence:CCGGGCAATTCGAGATCGTTTATTACTCGAGTAATAAACGATCTCGAATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015909.2-5774s21c1
Sequence:CCGGGATGACTAGAAAGGCTATTAACTCGAGTTAATAGCCTTTCTAGTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015909.2-2631s21c1
Sequence:CCGGCTTGGGATGGAGCGGAATATTCTCGAGAATATTCCGCTCCATCCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015909
VALIDATED
NBAS MISSION shRNA shRNA Plasmid DNA
neuroblastoma amplified sequence
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015909.2-737s21c1
Sequence:CCGGTGGAATCAACACAGCTATTTACTCGAGTAAATAGCTGTGTTGATTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015909.2-2869s21c1
Sequence:CCGGGTGTGGCTAATGAGCTATTAACTCGAGTTAATAGCTCATTAGCCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015909.2-189s21c1
Sequence:CCGGGCAATTCGAGATCGTTTATTACTCGAGTAATAAACGATCTCGAATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015909.2-5774s21c1
Sequence:CCGGGATGACTAGAAAGGCTATTAACTCGAGTTAATAGCCTTTCTAGTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015909.2-2631s21c1
Sequence:CCGGCTTGGGATGGAGCGGAATATTCTCGAGAATATTCCGCTCCATCCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015909
VALIDATED
NBAS MISSION shRNA Lentiviral Transduction Particles
neuroblastoma amplified sequence
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015909.2-737s21c1
Sequence:CCGGTGGAATCAACACAGCTATTTACTCGAGTAAATAGCTGTGTTGATTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015909.2-2869s21c1
Sequence:CCGGGTGTGGCTAATGAGCTATTAACTCGAGTTAATAGCTCATTAGCCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015909.2-189s21c1
Sequence:CCGGGCAATTCGAGATCGTTTATTACTCGAGTAATAAACGATCTCGAATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015909.2-5774s21c1
Sequence:CCGGGATGACTAGAAAGGCTATTAACTCGAGTTAATAGCCTTTCTAGTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015909.2-2631s21c1
Sequence:CCGGCTTGGGATGGAGCGGAATATTCTCGAGAATATTCCGCTCCATCCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)