EMAIL THIS PAGE TO A FRIEND

NBEA

neurobeachin

153 Gene Product Result for
Synonyms: BCL8B LYST2
Gene ID:
Human(26960) Summary: This gene encodes a member of a large, diverse group of A-kinase anchor proteins that target the activity of protein kinase A to specific subcellular sites by binding to its type II regulatory subunits. Brain-specific expression and coat protein-like membrane recruitment of a highly similar protein in mouse suggest an involvement in neuronal post-Golgi membrane traffic. Mutations in this gene may be associated with a form of autism. This gene and its expression are frequently disrupted in patients with multiple myeloma. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants may exist, but their full-length nature has not been determined.[provided by RefSeq, Feb 2011]
Mouse(26422) neurobeachin
Rat(310425) neurobeachin
sheep(101107611) neurobeachin
chicken(395195) neurobeachin
cow(525624) neurobeachin
Horse(100065416) neurobeachin
dog(477305) neurobeachin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015678 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015678 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015678 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030595 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030595 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030595 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015678 Rosetta Predictions human pricing
XM_227155 Rosetta Predictions rat pricing
NM_030595 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015678 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348326 predicted 4804
2 SASI_Hs02_00348327 predicted 7625
3 SASI_Hs01_00038039 predicted 1266
4 SASI_Hs01_00038041 predicted 7494
5 SASI_Hs01_00038043 predicted 2126
6 SASI_Hs01_00038046 predicted 3192
7 SASI_Hs01_00038047 predicted 2112
8 SASI_Hs01_00038048 predicted 5386
9 SASI_Hs02_00348328 predicted 4785
10 SASI_Hs02_00348329 predicted 8114
11 SASI_Hs01_00038040 predicted 2374
12 SASI_Hs01_00038042 predicted 6887
13 SASI_Hs01_00038044 predicted 8336
14 SASI_Hs01_00038045 predicted 8182
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227155 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00141038 predicted 497
2 SASI_Rn01_00141039 predicted 1383
3 SASI_Rn01_00141040 predicted 1185
4 SASI_Rn01_00141041 predicted 1148
5 SASI_Rn01_00141042 predicted 851
6 SASI_Rn01_00141043 predicted 486
7 SASI_Rn01_00141044 predicted 1538
8 SASI_Rn01_00141045 predicted 1564
9 SASI_Rn01_00141046 predicted 925
10 SASI_Rn01_00141047 predicted 269
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030595 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336783 predicted 7731
2 SASI_Mm02_00336784 predicted 8570
3 SASI_Mm02_00336785 predicted 1865
4 SASI_Mm02_00336786 predicted 8379
5 SASI_Mm02_00336787 predicted 1493
6 SASI_Mm02_00336788 predicted 1653
7 SASI_Mm02_00336789 predicted 5254
8 SASI_Mm02_00336790 predicted 985
9 SASI_Mm02_00336791 predicted 950
10 SASI_Mm02_00336792 predicted 1208
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015678
VALIDATED
NBEA MISSION shRNA Bacterial Glycerol Stock
neurobeachin
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015678.4-3952s21c1
Sequence:CCGGCCCAATAGTAGTACATCATTTCTCGAGAAATGATGTACTACTATTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015678.4-7449s21c1
Sequence:CCGGTATTGCAGGACGGACATATAACTCGAGTTATATGTCCGTCCTGCAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015678.4-1320s21c1
Sequence:CCGGGTTTCGTATGGATCCATTAAACTCGAGTTTAATGGATCCATACGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_015678.2-8068s1c1
Sequence:CCGGGCCGACTCTTTGCAGTGAATACTCGAGTATTCACTGCAAAGAGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_015678.2-416s1c1
Sequence:CCGGCCGGATGAAATTCGCAGTGTTCTCGAGAACACTGCGAATTTCATCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015678.2-6511s1c1
Sequence:CCGGGCACGGAAGAAGATGTAGTAACTCGAGTTACTACATCTTCTTCCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015678.2-4179s1c1
Sequence:CCGGCGGACTACAATGTTTCGTATTCTCGAGAATACGAAACATTGTAGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015678.2-1233s1c1
Sequence:CCGGCGGTGTTATGTTAATGGACAACTCGAGTTGTCCATTAACATAACACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015678
VALIDATED
NBEA MISSION shRNA shRNA Plasmid DNA
neurobeachin
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015678.4-3952s21c1
Sequence:CCGGCCCAATAGTAGTACATCATTTCTCGAGAAATGATGTACTACTATTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015678.4-7449s21c1
Sequence:CCGGTATTGCAGGACGGACATATAACTCGAGTTATATGTCCGTCCTGCAATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015678.4-1320s21c1
Sequence:CCGGGTTTCGTATGGATCCATTAAACTCGAGTTTAATGGATCCATACGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_015678.2-8068s1c1
Sequence:CCGGGCCGACTCTTTGCAGTGAATACTCGAGTATTCACTGCAAAGAGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_015678.2-416s1c1
Sequence:CCGGCCGGATGAAATTCGCAGTGTTCTCGAGAACACTGCGAATTTCATCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015678.2-6511s1c1
Sequence:CCGGGCACGGAAGAAGATGTAGTAACTCGAGTTACTACATCTTCTTCCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015678.2-4179s1c1
Sequence:CCGGCGGACTACAATGTTTCGTATTCTCGAGAATACGAAACATTGTAGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015678.2-1233s1c1
Sequence:CCGGCGGTGTTATGTTAATGGACAACTCGAGTTGTCCATTAACATAACACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015678
VALIDATED
NBEA MISSION shRNA Lentiviral Transduction Particles
neurobeachin
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015678.4-3952s21c1
Sequence:CCGGCCCAATAGTAGTACATCATTTCTCGAGAAATGATGTACTACTATTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015678.4-7449s21c1
Sequence:CCGGTATTGCAGGACGGACATATAACTCGAGTTATATGTCCGTCCTGCAATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015678.4-1320s21c1
Sequence:CCGGGTTTCGTATGGATCCATTAAACTCGAGTTTAATGGATCCATACGAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_015678.2-8068s1c1
Sequence:CCGGGCCGACTCTTTGCAGTGAATACTCGAGTATTCACTGCAAAGAGTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_015678.2-416s1c1
Sequence:CCGGCCGGATGAAATTCGCAGTGTTCTCGAGAACACTGCGAATTTCATCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015678.2-6511s1c1
Sequence:CCGGGCACGGAAGAAGATGTAGTAACTCGAGTTACTACATCTTCTTCCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015678.2-4179s1c1
Sequence:CCGGCGGACTACAATGTTTCGTATTCTCGAGAATACGAAACATTGTAGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015678.2-1233s1c1
Sequence:CCGGCGGTGTTATGTTAATGGACAACTCGAGTTGTCCATTAACATAACACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030595
NBEA MISSION shRNA Bacterial Glycerol Stock
neurobeachin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030595.1-7352s21c1
Sequence:CCGGATAGCAGGTCGGACGTATAATCTCGAGATTATACGTCCGACCTGCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030595.1-7921s21c1
Sequence:CCGGTCAATGGATTGACCTTATATTCTCGAGAATATAAGGTCAATCCATTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030595.1-10256s21c1
Sequence:CCGGATAACGAGTCAGACCGTATTACTCGAGTAATACGGTCTGACTCGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030595.1-1222s21c1
Sequence:CCGGGTTTCGAATGGATCCATTAAACTCGAGTTTAATGGATCCATTCGAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030595.1-868s21c1
Sequence:CCGGACGGAAGAGTGTTCGGAATTTCTCGAGAAATTCCGAACACTCTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030595
NBEA MISSION shRNA shRNA Plasmid DNA
neurobeachin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030595.1-7352s21c1
Sequence:CCGGATAGCAGGTCGGACGTATAATCTCGAGATTATACGTCCGACCTGCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030595.1-7921s21c1
Sequence:CCGGTCAATGGATTGACCTTATATTCTCGAGAATATAAGGTCAATCCATTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030595.1-10256s21c1
Sequence:CCGGATAACGAGTCAGACCGTATTACTCGAGTAATACGGTCTGACTCGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030595.1-1222s21c1
Sequence:CCGGGTTTCGAATGGATCCATTAAACTCGAGTTTAATGGATCCATTCGAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030595.1-868s21c1
Sequence:CCGGACGGAAGAGTGTTCGGAATTTCTCGAGAAATTCCGAACACTCTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030595
NBEA MISSION shRNA Lentiviral Transduction Particles
neurobeachin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030595.1-7352s21c1
Sequence:CCGGATAGCAGGTCGGACGTATAATCTCGAGATTATACGTCCGACCTGCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030595.1-7921s21c1
Sequence:CCGGTCAATGGATTGACCTTATATTCTCGAGAATATAAGGTCAATCCATTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030595.1-10256s21c1
Sequence:CCGGATAACGAGTCAGACCGTATTACTCGAGTAATACGGTCTGACTCGTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030595.1-1222s21c1
Sequence:CCGGGTTTCGAATGGATCCATTAAACTCGAGTTTAATGGATCCATTCGAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030595.1-868s21c1
Sequence:CCGGACGGAAGAGTGTTCGGAATTTCTCGAGAAATTCCGAACACTCTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)