EMAIL THIS PAGE TO A FRIEND

NBEAL1

neurobeachin-like 1

85 Gene Product Result for
Synonyms: A530083I02Rik ALS2CR16 ALS2CR17
Gene ID:
Mouse(269198) neurobeachin like 1
Rat(689253) neurobeachin-like 1
Zebrafish(100332617) neurobeachin-like 1
cow(524280) neurobeachin-like 1
Horse(100067598) neurobeachin-like 1
domestic cat(101088017) neurobeachin-like 1
dog(488482) neurobeachin-like 1
chicken(424110) neurobeachin-like 1
sheep(101112883) neurobeachin-like 1
domestic guinea pig(100713676) neurobeachin-like 1
naked mole-rat(101700422) neurobeachin-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198945 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198945 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198945 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173444 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173444 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173444 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099273 Rosetta Predictions human pricing
NM_198945 Rosetta Predictions human pricing
XM_001070133 Rosetta Predictions rat pricing
NM_173444 Rosetta Predictions mouse pricing
XM_990954 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099273 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320327 predicted 1279
2 SASI_Hs02_00320328 predicted 759
3 SASI_Hs02_00320329 predicted 866
4 SASI_Hs02_00320330 predicted 2455
5 SASI_Hs02_00320331 predicted 2624
6 SASI_Hs02_00320332 predicted 2017
7 SASI_Hs02_00320333 predicted 4142
8 SASI_Hs02_00320334 predicted 1347
9 SASI_Hs02_00320335 predicted 974
10 SASI_Hs02_00320336 predicted 1608
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198945 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372442 predicted 1281
2 SASI_Hs02_00372443 predicted 759
3 SASI_Hs02_00372444 predicted 870
4 SASI_Hs02_00372445 predicted 2455
5 SASI_Hs02_00372446 predicted 2624
6 SASI_Hs02_00372447 predicted 2015
7 SASI_Hs02_00372448 predicted 3933
8 SASI_Hs02_00372449 predicted 1343
9 SASI_Hs02_00372450 predicted 973
10 SASI_Hs02_00372451 predicted 1609
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070133 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00330548 predicted 4233
2 SASI_Rn02_00330549 predicted 4218
3 SASI_Rn02_00330550 predicted 3973
4 SASI_Rn02_00330551 predicted 3774
5 SASI_Rn02_00330552 predicted 338
6 SASI_Rn02_00330553 predicted 3613
7 SASI_Rn02_00330554 predicted 3345
8 SASI_Rn02_00330555 predicted 4203
9 SASI_Rn02_00330556 predicted 3814
10 SASI_Rn02_00330557 predicted 3172
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173444 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345341 predicted 6025
2 SASI_Mm02_00345342 predicted 4801
3 SASI_Mm02_00345343 predicted 2045
4 SASI_Mm02_00345344 predicted 7259
5 SASI_Mm02_00345345 predicted 2732
6 SASI_Mm02_00345346 predicted 5041
7 SASI_Mm02_00345347 predicted 7845
8 SASI_Mm02_00345348 predicted 5389
9 SASI_Mm02_00345349 predicted 8165
10 SASI_Mm02_00345350 predicted 3861
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_990954 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00202822 predicted 6032
2 SASI_Mm01_00202823 predicted 4805
3 SASI_Mm01_00202824 predicted 7445
4 SASI_Mm01_00202825 predicted 2733
5 SASI_Mm01_00202826 predicted 7028
6 SASI_Mm01_00202827 predicted 7213
7 SASI_Mm01_00202828 predicted 5046
8 SASI_Mm01_00202829 predicted 7643
9 SASI_Mm01_00202830 predicted 5397
10 SASI_Mm01_00202831 predicted 7967
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198945
VALIDATED
NBEAL1 MISSION shRNA Bacterial Glycerol Stock
neurobeachin-like 1
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157787    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198945.1-3810s1c1
Sequence:CCGGCGACTGCCTATCCATTGTGTTCTCGAGAACACAATGGATAGGCAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198945.1-2131s1c1
Sequence:CCGGGCCGACTGTTGTCACTTCATTCTCGAGAATGAAGTGACAACAGTCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_198945.1-3967s1c1
Sequence:CCGGGCCAGATTTCAGCTGGAGAAACTCGAGTTTCTCCAGCTGAAATCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198945.1-2341s1c1
Sequence:CCGGCGGAAGAGTTGGACCTTAATACTCGAGTATTAAGGTCCAACTCTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152094    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198945.1-4499s1c1
Sequence:CCGGCTCGGTGAAAGTTACAAGTTTCTCGAGAAACTTGTAACTTTCACCGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198945.1-3336s1c1
Sequence:CCGGGCTACAGATTACTGTGGAATACTCGAGTATTCCACAGTAATCTGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198945.1-3743s1c1
Sequence:CCGGCATACAAGGATTCCTGTCTATCTCGAGATAGACAGGAATCCTTGTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151804    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198945.1-4229s1c1
Sequence:CCGGCCTAAAGGTCATTGTATCCATCTCGAGATGGATACAATGACCTTTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262292    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198945.3-4205s21c1
Sequence:CCGGACAATTTGCTGTGGTATATAACTCGAGTTATATACCACAGCAAATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198945.3-2175s21c1
Sequence:CCGGAGATCACCACAGGAGTTATTCCTCGAGGAATAACTCCTGTGGTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198945.3-4103s21c1
Sequence:CCGGGATTACTGAAACCTGATTTATCTCGAGATAAATCAGGTTTCAGTAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_198945.3-1086s21c1
Sequence:CCGGCAGACTGAAATCTACTCATTTCTCGAGAAATGAGTAGATTTCAGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_198945.3-3528s21c1
Sequence:CCGGAGGGATGGAACGGTGATTATACTCGAGTATAATCACCGTTCCATCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198945.3-212s21c1
Sequence:CCGGAGACTCAAACACACCATTATTCTCGAGAATAATGGTGTGTTTGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_198945.3-3186s21c1
Sequence:CCGGGAGATCACTTCTAAGCTATTTCTCGAGAAATAGCTTAGAAGTGATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_198945.3-2340s21c1
Sequence:CCGGTCGGAAGAGTTGGACCTTAATCTCGAGATTAAGGTCCAACTCTTCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198945.3-3012s21c1
Sequence:CCGGCAAACACCCTGTCAATTATTACTCGAGTAATAATTGACAGGGTGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198945.3-2271s21c1
Sequence:CCGGATGGCAGGACGAACCTATAATCTCGAGATTATAGGTTCGTCCTGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198945
VALIDATED
NBEAL1 MISSION shRNA shRNA Plasmid DNA
neurobeachin-like 1
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157787    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198945.1-3810s1c1
Sequence:CCGGCGACTGCCTATCCATTGTGTTCTCGAGAACACAATGGATAGGCAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198945.1-2131s1c1
Sequence:CCGGGCCGACTGTTGTCACTTCATTCTCGAGAATGAAGTGACAACAGTCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_198945.1-3967s1c1
Sequence:CCGGGCCAGATTTCAGCTGGAGAAACTCGAGTTTCTCCAGCTGAAATCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198945.1-2341s1c1
Sequence:CCGGCGGAAGAGTTGGACCTTAATACTCGAGTATTAAGGTCCAACTCTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152094    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198945.1-4499s1c1
Sequence:CCGGCTCGGTGAAAGTTACAAGTTTCTCGAGAAACTTGTAACTTTCACCGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198945.1-3336s1c1
Sequence:CCGGGCTACAGATTACTGTGGAATACTCGAGTATTCCACAGTAATCTGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198945.1-3743s1c1
Sequence:CCGGCATACAAGGATTCCTGTCTATCTCGAGATAGACAGGAATCCTTGTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151804    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198945.1-4229s1c1
Sequence:CCGGCCTAAAGGTCATTGTATCCATCTCGAGATGGATACAATGACCTTTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262292    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198945.3-4205s21c1
Sequence:CCGGACAATTTGCTGTGGTATATAACTCGAGTTATATACCACAGCAAATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198945.3-2175s21c1
Sequence:CCGGAGATCACCACAGGAGTTATTCCTCGAGGAATAACTCCTGTGGTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198945.3-4103s21c1
Sequence:CCGGGATTACTGAAACCTGATTTATCTCGAGATAAATCAGGTTTCAGTAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_198945.3-1086s21c1
Sequence:CCGGCAGACTGAAATCTACTCATTTCTCGAGAAATGAGTAGATTTCAGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_198945.3-3528s21c1
Sequence:CCGGAGGGATGGAACGGTGATTATACTCGAGTATAATCACCGTTCCATCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198945.3-212s21c1
Sequence:CCGGAGACTCAAACACACCATTATTCTCGAGAATAATGGTGTGTTTGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_198945.3-3186s21c1
Sequence:CCGGGAGATCACTTCTAAGCTATTTCTCGAGAAATAGCTTAGAAGTGATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_198945.3-2340s21c1
Sequence:CCGGTCGGAAGAGTTGGACCTTAATCTCGAGATTAAGGTCCAACTCTTCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198945.3-3012s21c1
Sequence:CCGGCAAACACCCTGTCAATTATTACTCGAGTAATAATTGACAGGGTGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198945.3-2271s21c1
Sequence:CCGGATGGCAGGACGAACCTATAATCTCGAGATTATAGGTTCGTCCTGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198945
VALIDATED
NBEAL1 MISSION shRNA Lentiviral Transduction Particles
neurobeachin-like 1
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157787    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198945.1-3810s1c1
Sequence:CCGGCGACTGCCTATCCATTGTGTTCTCGAGAACACAATGGATAGGCAGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198945.1-2131s1c1
Sequence:CCGGGCCGACTGTTGTCACTTCATTCTCGAGAATGAAGTGACAACAGTCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_198945.1-3967s1c1
Sequence:CCGGGCCAGATTTCAGCTGGAGAAACTCGAGTTTCTCCAGCTGAAATCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198945.1-2341s1c1
Sequence:CCGGCGGAAGAGTTGGACCTTAATACTCGAGTATTAAGGTCCAACTCTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152094    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198945.1-4499s1c1
Sequence:CCGGCTCGGTGAAAGTTACAAGTTTCTCGAGAAACTTGTAACTTTCACCGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198945.1-3336s1c1
Sequence:CCGGGCTACAGATTACTGTGGAATACTCGAGTATTCCACAGTAATCTGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198945.1-3743s1c1
Sequence:CCGGCATACAAGGATTCCTGTCTATCTCGAGATAGACAGGAATCCTTGTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151804    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198945.1-4229s1c1
Sequence:CCGGCCTAAAGGTCATTGTATCCATCTCGAGATGGATACAATGACCTTTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262292    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198945.3-4205s21c1
Sequence:CCGGACAATTTGCTGTGGTATATAACTCGAGTTATATACCACAGCAAATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198945.3-2175s21c1
Sequence:CCGGAGATCACCACAGGAGTTATTCCTCGAGGAATAACTCCTGTGGTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198945.3-4103s21c1
Sequence:CCGGGATTACTGAAACCTGATTTATCTCGAGATAAATCAGGTTTCAGTAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_198945.3-1086s21c1
Sequence:CCGGCAGACTGAAATCTACTCATTTCTCGAGAAATGAGTAGATTTCAGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_198945.3-3528s21c1
Sequence:CCGGAGGGATGGAACGGTGATTATACTCGAGTATAATCACCGTTCCATCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198945.3-212s21c1
Sequence:CCGGAGACTCAAACACACCATTATTCTCGAGAATAATGGTGTGTTTGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_198945.3-3186s21c1
Sequence:CCGGGAGATCACTTCTAAGCTATTTCTCGAGAAATAGCTTAGAAGTGATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_198945.3-2340s21c1
Sequence:CCGGTCGGAAGAGTTGGACCTTAATCTCGAGATTAAGGTCCAACTCTTCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198945.3-3012s21c1
Sequence:CCGGCAAACACCCTGTCAATTATTACTCGAGTAATAATTGACAGGGTGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198945.3-2271s21c1
Sequence:CCGGATGGCAGGACGAACCTATAATCTCGAGATTATAGGTTCGTCCTGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173444
VALIDATED
NBEAL1 MISSION shRNA Bacterial Glycerol Stock
neurobeachin-like 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173444.2-3275s21c1
Sequence:CCGGCTAATTGAGCAGGTATCATTACTCGAGTAATGATACCTGCTCAATTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173444.2-8637s21c1
Sequence:CCGGGGTTGTATTAAGTCCATATTTCTCGAGAAATATGGACTTAATACAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173444.2-7269s21c1
Sequence:CCGGGTGATGGTATTCCACTATTAACTCGAGTTAATAGTGGAATACCATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249524    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173444.2-9350s21c1
Sequence:CCGGACCCGGATGATTACGAGTTATCTCGAGATAACTCGTAATCATCCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173444.2-3602s21c1
Sequence:CCGGCAGAGTATCATAGGTTATATACTCGAGTATATAACCTATGATACTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173444.2-5135s21c1
Sequence:CCGGCAAGATGAAGCATGCTATATTCTCGAGAATATAGCATGCTTCATCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173444.2-6380s21c1
Sequence:CCGGATGGCAGGACGAACCTATAATCTCGAGATTATAGGTTCGTCCTGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173444.2-2046s21c1
Sequence:CCGGCACATAGCATGGCCGGAATTTCTCGAGAAATTCCGGCCATGCTATGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173444
VALIDATED
NBEAL1 MISSION shRNA shRNA Plasmid DNA
neurobeachin-like 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173444.2-3275s21c1
Sequence:CCGGCTAATTGAGCAGGTATCATTACTCGAGTAATGATACCTGCTCAATTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173444.2-8637s21c1
Sequence:CCGGGGTTGTATTAAGTCCATATTTCTCGAGAAATATGGACTTAATACAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173444.2-7269s21c1
Sequence:CCGGGTGATGGTATTCCACTATTAACTCGAGTTAATAGTGGAATACCATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249524    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173444.2-9350s21c1
Sequence:CCGGACCCGGATGATTACGAGTTATCTCGAGATAACTCGTAATCATCCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173444.2-3602s21c1
Sequence:CCGGCAGAGTATCATAGGTTATATACTCGAGTATATAACCTATGATACTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173444.2-5135s21c1
Sequence:CCGGCAAGATGAAGCATGCTATATTCTCGAGAATATAGCATGCTTCATCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173444.2-6380s21c1
Sequence:CCGGATGGCAGGACGAACCTATAATCTCGAGATTATAGGTTCGTCCTGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173444.2-2046s21c1
Sequence:CCGGCACATAGCATGGCCGGAATTTCTCGAGAAATTCCGGCCATGCTATGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173444
VALIDATED
NBEAL1 MISSION shRNA Lentiviral Transduction Particles
neurobeachin-like 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173444.2-3275s21c1
Sequence:CCGGCTAATTGAGCAGGTATCATTACTCGAGTAATGATACCTGCTCAATTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173444.2-8637s21c1
Sequence:CCGGGGTTGTATTAAGTCCATATTTCTCGAGAAATATGGACTTAATACAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173444.2-7269s21c1
Sequence:CCGGGTGATGGTATTCCACTATTAACTCGAGTTAATAGTGGAATACCATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249524    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173444.2-9350s21c1
Sequence:CCGGACCCGGATGATTACGAGTTATCTCGAGATAACTCGTAATCATCCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173444.2-3602s21c1
Sequence:CCGGCAGAGTATCATAGGTTATATACTCGAGTATATAACCTATGATACTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173444.2-5135s21c1
Sequence:CCGGCAAGATGAAGCATGCTATATTCTCGAGAATATAGCATGCTTCATCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173444.2-6380s21c1
Sequence:CCGGATGGCAGGACGAACCTATAATCTCGAGATTATAGGTTCGTCCTGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173444.2-2046s21c1
Sequence:CCGGCACATAGCATGGCCGGAATTTCTCGAGAAATTCCGGCCATGCTATGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)