EMAIL THIS PAGE TO A FRIEND

NBEAL2

neurobeachin-like 2

85 Gene Product Result for
Synonyms: BDPLT4 GPS
UniProtKB ID: Q6ZNJ1, O60288, Q6P994, Q6UX91, Q8NAC9
Gene ID:
Human(23218) Summary: The protein encoded by this gene contains a beige and Chediak-Higashi (BEACH) domain and multiple WD40 domains, and may play a role in megakaryocyte alpha-granule biogenesis. Mutations in this gene are a cause of gray platelet syndrome. [provided by RefSeq, Dec 2011]
Mouse(235627) neurobeachin-like 2
Rat(316014) neurobeachin-like 2
naked mole-rat(101713722) neurobeachin-like 2
domestic guinea pig(100718890) neurobeachin-like 2
sheep(101123589) neurobeachin-like 2
Zebrafish(100330830) neurobeachin-like 2
cow(788207) neurobeachin-like 2
Horse(100064971) neurobeachin-like 2
domestic cat(101096452) neurobeachin-like 2
dog(484784) neurobeachin-like 2
chicken(425984) neurobeachin-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015175 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015175 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015175 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015175 Rosetta Predictions human pricing
XM_291064 Rosetta Predictions human pricing
XM_001077277 Rosetta Predictions rat pricing
XM_236649 Rosetta Predictions rat pricing
XM_150243 Rosetta Predictions mouse pricing
XM_911187 Rosetta Predictions mouse pricing
XM_977572 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015175 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347190 predicted 6159
2 SASI_Hs02_00347191 predicted 4903
3 SASI_Hs02_00347192 predicted 6626
4 SASI_Hs02_00347193 predicted 6381
5 SASI_Hs02_00347194 predicted 2151
6 SASI_Hs02_00347195 predicted 3042
7 SASI_Hs02_00347196 predicted 5346
8 SASI_Hs02_00347197 predicted 3344
9 SASI_Hs02_00347198 predicted 2943
10 SASI_Hs02_00347199 predicted 5332
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_291064 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00263073 predicted 7828
2 SASI_Hs01_00263074 predicted 5969
3 SASI_Hs01_00263075 predicted 5376
4 SASI_Hs01_00263076 predicted 8034
5 SASI_Hs01_00263077 predicted 6980
6 SASI_Hs01_00263078 predicted 6588
7 SASI_Hs01_00263079 predicted 6783
8 SASI_Hs01_00263080 predicted 5302
9 SASI_Hs01_00263081 predicted 5320
10 SASI_Hs01_00263082 predicted 5646
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077277 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00356530 predicted 5368
2 SASI_Rn02_00356531 predicted 4940
3 SASI_Rn02_00356532 predicted 5350
4 SASI_Rn02_00356533 predicted 4272
5 SASI_Rn02_00356534 predicted 8186
6 SASI_Rn02_00356535 predicted 7395
7 SASI_Rn02_00356536 predicted 8284
8 SASI_Rn02_00356537 predicted 2699
9 SASI_Rn02_00356538 predicted 7938
10 SASI_Rn02_00356539 predicted 6635
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236649 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390269 predicted 5367
2 SASI_Rn02_00390270 predicted 4935
3 SASI_Rn02_00390271 predicted 5354
4 SASI_Rn02_00390272 predicted 4274
5 SASI_Rn02_00390273 predicted 8192
6 SASI_Rn02_00390274 predicted 7398
7 SASI_Rn02_00390275 predicted 8276
8 SASI_Rn02_00390276 predicted 2699
9 SASI_Rn02_00390277 predicted 7933
10 SASI_Rn02_00390278 predicted 6635
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_150243 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00425397 predicted 5934
2 SASI_Mm02_00425398 predicted 1335
3 SASI_Mm02_00425399 predicted 4178
4 SASI_Mm02_00425400 predicted 7835
5 SASI_Mm02_00425401 predicted 6523
6 SASI_Mm02_00425402 predicted 1254
7 SASI_Mm02_00425403 predicted 4466
8 SASI_Mm02_00425404 predicted 2255
9 SASI_Mm02_00425405 predicted 2052
10 SASI_Mm02_00425406 predicted 6361
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_911187 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00436247 predicted 8209
2 SASI_Mm02_00436248 predicted 6045
3 SASI_Mm02_00436249 predicted 1322
4 SASI_Mm02_00436250 predicted 4292
5 SASI_Mm02_00436251 predicted 7964
6 SASI_Mm02_00436252 predicted 6653
7 SASI_Mm02_00436253 predicted 4578
8 SASI_Mm02_00436254 predicted 2250
9 SASI_Mm02_00436255 predicted 2047
10 SASI_Mm02_00436256 predicted 6467
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_977572 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00446367 predicted 6423
2 SASI_Mm02_00446368 predicted 1226
3 SASI_Mm01_00214265 predicted 1324
4 SASI_Mm02_00446369 predicted 6436
5 SASI_Mm01_00214268 predicted 6658
6 SASI_Mm02_00446370 predicted 1243
7 SASI_Mm02_00446371 predicted 1103
8 SASI_Mm02_00446372 predicted 7369
9 SASI_Mm02_00446373 predicted 7485
10 SASI_Mm02_00446374 predicted 6471
11 SASI_Mm01_00214264 predicted 6041
12 SASI_Mm01_00214266 predicted 4283
13 SASI_Mm01_00214267 predicted 7959
14 SASI_Mm01_00214269 predicted 8251
15 SASI_Mm01_00214270 predicted 4572
16 SASI_Mm01_00214271 predicted 2698
17 SASI_Mm01_00214272 predicted 6190
18 SASI_Mm01_00214273 predicted 2220
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015175
NBEAL2 MISSION shRNA Bacterial Glycerol Stock
neurobeachin-like 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015175.1-2147s21c1
Sequence:CCGGGTGCACACGGAAGGAGTATTTCTCGAGAAATACTCCTTCCGTGTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015175.1-7447s21c1
Sequence:CCGGTGCCCTATGACCGCAACATAACTCGAGTTATGTTGCGGTCATAGGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015175.1-5665s21c1
Sequence:CCGGTGTCCAGCGCCGAGACATATTCTCGAGAATATGTCTCGGCGCTGGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015175.1-2977s21c1
Sequence:CCGGTGGTTCTCCCATTGGGTAAATCTCGAGATTTACCCAATGGGAGAACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015175.1-4035s21c1
Sequence:CCGGGATGTGCTGACCCGGCTATATCTCGAGATATAGCCGGGTCAGCACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015175
NBEAL2 MISSION shRNA shRNA Plasmid DNA
neurobeachin-like 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015175.1-2147s21c1
Sequence:CCGGGTGCACACGGAAGGAGTATTTCTCGAGAAATACTCCTTCCGTGTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015175.1-7447s21c1
Sequence:CCGGTGCCCTATGACCGCAACATAACTCGAGTTATGTTGCGGTCATAGGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015175.1-5665s21c1
Sequence:CCGGTGTCCAGCGCCGAGACATATTCTCGAGAATATGTCTCGGCGCTGGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015175.1-2977s21c1
Sequence:CCGGTGGTTCTCCCATTGGGTAAATCTCGAGATTTACCCAATGGGAGAACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015175.1-4035s21c1
Sequence:CCGGGATGTGCTGACCCGGCTATATCTCGAGATATAGCCGGGTCAGCACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015175
NBEAL2 MISSION shRNA Lentiviral Transduction Particles
neurobeachin-like 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015175.1-2147s21c1
Sequence:CCGGGTGCACACGGAAGGAGTATTTCTCGAGAAATACTCCTTCCGTGTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015175.1-7447s21c1
Sequence:CCGGTGCCCTATGACCGCAACATAACTCGAGTTATGTTGCGGTCATAGGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015175.1-5665s21c1
Sequence:CCGGTGTCCAGCGCCGAGACATATTCTCGAGAATATGTCTCGGCGCTGGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015175.1-2977s21c1
Sequence:CCGGTGGTTCTCCCATTGGGTAAATCTCGAGATTTACCCAATGGGAGAACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015175.1-4035s21c1
Sequence:CCGGGATGTGCTGACCCGGCTATATCTCGAGATATAGCCGGGTCAGCACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)