EMAIL THIS PAGE TO A FRIEND

NBN

nibrin

83 Gene Product Result for
Synonyms: AT-V1 AT-V2 ATV NBS NBS1 P95
Gene ID:
Human(4683) Summary: Mutations in this gene are associated with Nijmegen breakage syndrome, an autosomal recessive chromosomal instability syndrome characterized by microcephaly, growth retardation, immunodeficiency, and cancer predisposition. The encoded protein is a member of the MRE11/RAD50 double-strand break repair complex which consists of 5 proteins. This gene product is thought to be involved in DNA double-strand break repair and DNA damage-induced checkpoint activation. [provided by RefSeq, Jul 2008]
Mouse(27354) nibrin
Rat(85482) nibrin
cow(522943) nibrin
dog(611315) nibrin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300338 Anti-NBN (Ab-343) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
HPA001429 Anti-NBN antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB4501958 Anti-NBN antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
N6411 Anti-NBS.1 antibody produced in rabbit affinity isolated antibody, ammonium sulfate suspension human, rodent
immunohistochemistry, western blot pricing
N3162 Anti-NBS1 (Nibrin) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human, canine, chimpanzee
immunofluorescence, immunoprecipitation (IP), microarray, western blot pricing
N3037 Anti-NBS1 (Nibrin), C-terminal antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunofluorescence, immunoprecipitation (IP), microarray, western blot pricing
SAB4501956 Anti-Nibrin antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, western blot pricing
SAB4501957 Anti-p95 antibody produced in rabbit affinity isolated antibody human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4300045 Anti-phospho-NBN (pSer343) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4504312 Anti-phospho-Nibrin (pSer278) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, western blot pricing
SAB4504479 Anti-phospho-p95/NBS1 (pSer343) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
WH0004683M1 Monoclonal Anti-NBN antibody produced in mouse clone 3E4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB4100603 Monoclonal Anti-NBN antibody produced in mouse clone NBN-A589, culture supernatant human
western blot pricing
SAB1404110 Monoclonal Anti-NBN, (C-terminal) antibody produced in mouse clone 2C7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
N9287 Monoclonal Anti-NBS1 (Nibrin) antibody produced in mouse ~2 mg/mL, clone NBS1-501, purified immunoglobulin, buffered aqueous solution human
immunocytochemistry, immunoprecipitation (IP), microarray, western blot pricing
PLA0179 Rabbit anti-NBS1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human
immunohistochemistry, immunoprecipitation (IP), proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002485 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002485 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002485 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013752 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013752 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013752 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU039471 MISSION® esiRNA esiRNA human NBN (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024688 Rosetta Predictions human pricing
NM_002485 Rosetta Predictions human pricing
NM_138873 Rosetta Predictions rat pricing
NM_013752 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024688 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122978 predicted 2169
2 SASI_Hs01_00122979 predicted 2311
3 SASI_Hs01_00122980 predicted 1814
4 SASI_Hs01_00122981 predicted 1426
5 SASI_Hs01_00122982 predicted 2077
6 SASI_Hs01_00122983 predicted 1361
7 SASI_Hs01_00122984 predicted 2262
8 SASI_Hs01_00122985 predicted 1907
9 SASI_Hs01_00122986 predicted 1605
10 SASI_Hs01_00122987 predicted 1874
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002485 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333919 predicted 232
2 SASI_Hs02_00333920 predicted 324
3 SASI_Hs01_00058029 predicted 2109
4 SASI_Hs01_00058030 predicted 2254
5 SASI_Hs01_00058031 predicted 1761
6 SASI_Hs01_00058033 predicted 2025
7 SASI_Hs01_00058035 predicted 2208
8 SASI_Hs01_00058037 predicted 1542
9 SASI_Hs02_00333921 predicted 1208
10 SASI_Hs01_00058038 predicted 1823
11 SASI_Hs01_00058032 predicted 1374
12 SASI_Hs01_00058034 predicted 1310
13 SASI_Hs01_00058036 predicted 1858
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138873 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096946 predicted 2287
2 SASI_Rn01_00096947 predicted 1723
3 SASI_Rn02_00268287 predicted 1449
4 SASI_Rn02_00268288 predicted 1340
5 SASI_Rn01_00096948 predicted 636
6 SASI_Rn01_00096949 predicted 1317
7 SASI_Rn01_00096950 predicted 1281
8 SASI_Rn01_00096951 predicted 257
9 SASI_Rn01_00096952 predicted 2378
10 SASI_Rn01_00096953 predicted 1910
11 SASI_Rn01_00096954 predicted 1158
12 SASI_Rn01_00096955 predicted 2055
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013752 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322696 predicted 282
2 SASI_Mm01_00173717 predicted 322
3 SASI_Mm02_00322697 predicted 2082
4 SASI_Mm01_00173718 predicted 2250
5 SASI_Mm01_00173719 predicted 1788
6 SASI_Mm02_00322698 predicted 403
7 SASI_Mm01_00173720 predicted 2048
8 SASI_Mm01_00173721 predicted 261
9 SASI_Mm01_00173722 predicted 1224
10 SASI_Mm01_00173723 predicted 593
11 SASI_Mm01_00173715 predicted 2103
12 SASI_Mm01_00173716 predicted 2110
13 SASI_Mm01_00173724 predicted 2087
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002485
VALIDATED
NBN MISSION shRNA Bacterial Glycerol Stock
nibrin
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002485.x-440s1c1
Sequence:CCGGCAAGCTATATTGCAACTTGGACTCGAGTCCAAGTTGCAATATAGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_002485.4-2247s21c1
Sequence:CCGGGCTCGAAAGAATACAGAACTACTCGAGTAGTTCTGTATTCTTTCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_002485.4-1220s21c1
Sequence:CCGGGCAAGCAGATACATGGGATTTCTCGAGAAATCCCATGTATCTGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002485.4-1091s21c1
Sequence:CCGGCCATCCCAGTACAGGATTAAACTCGAGTTTAATCCTGTACTGGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040133    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002485.3-3107s1c1
Sequence:CCGGGCTTATTTAGAGTCCTAGTTTCTCGAGAAACTAGGACTCTAAATAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002485.3-235s1c1
Sequence:CCGGGCCGAAATCATGCTGTGTTAACTCGAGTTAACACAGCATGATTTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_002485.3-2247s1c1
Sequence:CCGGGCTCGAAAGAATACAGAACTACTCGAGTAGTTCTGTATTCTTTCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002485.3-705s1c1
Sequence:CCGGCCTCTTGATGAACCATCTATTCTCGAGAATAGATGGTTCATCAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002485.3-1220s1c1
Sequence:CCGGGCAAGCAGATACATGGGATTTCTCGAGAAATCCCATGTATCTGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002485.x-2210s1c1
Sequence:CCGGAAGAGTGGCTAAGGCAGGAACTCGAGTTCCTGCCTTAGCCACTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002485.4-705s21c1
Sequence:CCGGCCTCTTGATGAACCATCTATTCTCGAGAATAGATGGTTCATCAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288623    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002485.4-3107s21c1
Sequence:CCGGGCTTATTTAGAGTCCTAGTTTCTCGAGAAACTAGGACTCTAAATAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002485
VALIDATED
NBN MISSION shRNA shRNA Plasmid DNA
nibrin
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002485.x-440s1c1
Sequence:CCGGCAAGCTATATTGCAACTTGGACTCGAGTCCAAGTTGCAATATAGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_002485.4-2247s21c1
Sequence:CCGGGCTCGAAAGAATACAGAACTACTCGAGTAGTTCTGTATTCTTTCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_002485.4-1220s21c1
Sequence:CCGGGCAAGCAGATACATGGGATTTCTCGAGAAATCCCATGTATCTGCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002485.4-1091s21c1
Sequence:CCGGCCATCCCAGTACAGGATTAAACTCGAGTTTAATCCTGTACTGGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040133    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002485.3-3107s1c1
Sequence:CCGGGCTTATTTAGAGTCCTAGTTTCTCGAGAAACTAGGACTCTAAATAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002485.3-235s1c1
Sequence:CCGGGCCGAAATCATGCTGTGTTAACTCGAGTTAACACAGCATGATTTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_002485.3-2247s1c1
Sequence:CCGGGCTCGAAAGAATACAGAACTACTCGAGTAGTTCTGTATTCTTTCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002485.3-705s1c1
Sequence:CCGGCCTCTTGATGAACCATCTATTCTCGAGAATAGATGGTTCATCAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002485.3-1220s1c1
Sequence:CCGGGCAAGCAGATACATGGGATTTCTCGAGAAATCCCATGTATCTGCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002485.x-2210s1c1
Sequence:CCGGAAGAGTGGCTAAGGCAGGAACTCGAGTTCCTGCCTTAGCCACTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002485.4-705s21c1
Sequence:CCGGCCTCTTGATGAACCATCTATTCTCGAGAATAGATGGTTCATCAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288623    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002485.4-3107s21c1
Sequence:CCGGGCTTATTTAGAGTCCTAGTTTCTCGAGAAACTAGGACTCTAAATAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002485
VALIDATED
NBN MISSION shRNA Lentiviral Transduction Particles
nibrin
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002485.x-440s1c1
Sequence:CCGGCAAGCTATATTGCAACTTGGACTCGAGTCCAAGTTGCAATATAGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_002485.4-2247s21c1
Sequence:CCGGGCTCGAAAGAATACAGAACTACTCGAGTAGTTCTGTATTCTTTCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_002485.4-1220s21c1
Sequence:CCGGGCAAGCAGATACATGGGATTTCTCGAGAAATCCCATGTATCTGCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002485.4-1091s21c1
Sequence:CCGGCCATCCCAGTACAGGATTAAACTCGAGTTTAATCCTGTACTGGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040133    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002485.3-3107s1c1
Sequence:CCGGGCTTATTTAGAGTCCTAGTTTCTCGAGAAACTAGGACTCTAAATAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002485.3-235s1c1
Sequence:CCGGGCCGAAATCATGCTGTGTTAACTCGAGTTAACACAGCATGATTTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_002485.3-2247s1c1
Sequence:CCGGGCTCGAAAGAATACAGAACTACTCGAGTAGTTCTGTATTCTTTCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002485.3-705s1c1
Sequence:CCGGCCTCTTGATGAACCATCTATTCTCGAGAATAGATGGTTCATCAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002485.3-1220s1c1
Sequence:CCGGGCAAGCAGATACATGGGATTTCTCGAGAAATCCCATGTATCTGCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002485.x-2210s1c1
Sequence:CCGGAAGAGTGGCTAAGGCAGGAACTCGAGTTCCTGCCTTAGCCACTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002485.4-705s21c1
Sequence:CCGGCCTCTTGATGAACCATCTATTCTCGAGAATAGATGGTTCATCAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288623    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002485.4-3107s21c1
Sequence:CCGGGCTTATTTAGAGTCCTAGTTTCTCGAGAAACTAGGACTCTAAATAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013752
VALIDATED
NBN MISSION shRNA Bacterial Glycerol Stock
nibrin
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013752.3-1030s21c1
Sequence:CCGGCGGAGATTGGATTGGCTGTTACTCGAGTAACAGCCAATCCAATCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013752.2-2065s1c1
Sequence:CCGGGCTGACTGAATTTAGGTCATTCTCGAGAATGACCTAAATTCAGTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013752.3-286s21c1
Sequence:CCGGCAGATGAAATTCCTACATTAACTCGAGTTAATGTAGGAATTTCATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012668    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013752.2-2380s1c1
Sequence:CCGGAGCTGTAGAAACACATTTCTACTCGAGTAGAAATGTGTTTCTACAGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013752.2-1823s1c1
Sequence:CCGGGCAGTTCAAGTGAAGGTTGAACTCGAGTTCAACCTTCACTTGAACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013752.2-564s1c1
Sequence:CCGGCGGCAGTTAAAGTCACCATTACTCGAGTAATGGTGACTTTAACTGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013752.2-1029s1c1
Sequence:CCGGCGGAGATTGGATTGGCTGTTACTCGAGTAACAGCCAATCCAATCTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013752.3-603s21c1
Sequence:CCGGATTTGTGGACGTCCAATTATACTCGAGTATAATTGGACGTCCACAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273047    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013752.3-2381s21c1
Sequence:CCGGAGCTGTAGAAACACATTTCTACTCGAGTAGAAATGTGTTTCTACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013752.3-1824s21c1
Sequence:CCGGGCAGTTCAAGTGAAGGTTGAACTCGAGTTCAACCTTCACTTGAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013752
VALIDATED
NBN MISSION shRNA shRNA Plasmid DNA
nibrin
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013752.3-1030s21c1
Sequence:CCGGCGGAGATTGGATTGGCTGTTACTCGAGTAACAGCCAATCCAATCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013752.2-2065s1c1
Sequence:CCGGGCTGACTGAATTTAGGTCATTCTCGAGAATGACCTAAATTCAGTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013752.3-286s21c1
Sequence:CCGGCAGATGAAATTCCTACATTAACTCGAGTTAATGTAGGAATTTCATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012668    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013752.2-2380s1c1
Sequence:CCGGAGCTGTAGAAACACATTTCTACTCGAGTAGAAATGTGTTTCTACAGCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013752.2-1823s1c1
Sequence:CCGGGCAGTTCAAGTGAAGGTTGAACTCGAGTTCAACCTTCACTTGAACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013752.2-564s1c1
Sequence:CCGGCGGCAGTTAAAGTCACCATTACTCGAGTAATGGTGACTTTAACTGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013752.2-1029s1c1
Sequence:CCGGCGGAGATTGGATTGGCTGTTACTCGAGTAACAGCCAATCCAATCTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013752.3-603s21c1
Sequence:CCGGATTTGTGGACGTCCAATTATACTCGAGTATAATTGGACGTCCACAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273047    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013752.3-2381s21c1
Sequence:CCGGAGCTGTAGAAACACATTTCTACTCGAGTAGAAATGTGTTTCTACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013752.3-1824s21c1
Sequence:CCGGGCAGTTCAAGTGAAGGTTGAACTCGAGTTCAACCTTCACTTGAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013752
VALIDATED
NBN MISSION shRNA Lentiviral Transduction Particles
nibrin
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013752.3-1030s21c1
Sequence:CCGGCGGAGATTGGATTGGCTGTTACTCGAGTAACAGCCAATCCAATCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013752.2-2065s1c1
Sequence:CCGGGCTGACTGAATTTAGGTCATTCTCGAGAATGACCTAAATTCAGTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013752.3-286s21c1
Sequence:CCGGCAGATGAAATTCCTACATTAACTCGAGTTAATGTAGGAATTTCATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012668    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013752.2-2380s1c1
Sequence:CCGGAGCTGTAGAAACACATTTCTACTCGAGTAGAAATGTGTTTCTACAGCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013752.2-1823s1c1
Sequence:CCGGGCAGTTCAAGTGAAGGTTGAACTCGAGTTCAACCTTCACTTGAACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013752.2-564s1c1
Sequence:CCGGCGGCAGTTAAAGTCACCATTACTCGAGTAATGGTGACTTTAACTGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013752.2-1029s1c1
Sequence:CCGGCGGAGATTGGATTGGCTGTTACTCGAGTAACAGCCAATCCAATCTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013752.3-603s21c1
Sequence:CCGGATTTGTGGACGTCCAATTATACTCGAGTATAATTGGACGTCCACAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273047    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013752.3-2381s21c1
Sequence:CCGGAGCTGTAGAAACACATTTCTACTCGAGTAGAAATGTGTTTCTACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013752.3-1824s21c1
Sequence:CCGGGCAGTTCAAGTGAAGGTTGAACTCGAGTTCAACCTTCACTTGAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)