EMAIL THIS PAGE TO A FRIEND

NBPF10

neuroblastoma breakpoint family, member 10

88 Gene Product Result for
Synonyms: AB6 AG1 NBPF9
Species: Human NBPF10(100132406)
UniProtKB ID: Q6P3W6, Q5RHC0, Q9NWN6
Gene ID:
Human(100132406) Summary: This gene is a member of the neuroblastoma breakpoint family (NBPF) which consists of dozens of recently duplicated genes primarily located in segmental duplications on human chromosome 1. This gene family has experienced its greatest expansion within the human lineage and has expanded, to a lesser extent, among primates in general. Members of this gene family are characterized by tandemly repeated copies of DUF1220 protein domains. Gene copy number variations in the human chromosomal region 1q21.1, where most DUF1220 domains are located, have been implicated in a number of developmental and neurogenetic diseases such as microcephaly, macrocephaly, autism, schizophrenia, mental retardation, congenital heart disease, neuroblastoma, and congenital kidney and urinary tract anomalies. Altered expression of some gene family members is associated with several types of cancer. This gene family contains numerous pseudogenes. [provided by RefSeq, Apr 2013]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001039703 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039703 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039703 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039703 Rosetta Predictions human pricing
XM_001722184 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039703 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024566 predicted 2484
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001722184 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00447671 predicted 2898
2 SASI_Hs02_00447672 predicted 2993
3 SASI_Hs02_00447673 predicted 2864
4 SASI_Hs02_00447674 predicted 2887
5 SASI_Hs02_00447675 predicted 3191
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039703
VALIDATED
NBPF10 MISSION shRNA Bacterial Glycerol Stock
neuroblastoma breakpoint family, member 10
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001039703.2-1504s21c1
Sequence:CCGGGTGCCATCACTTGTTCGAATACTCGAGTATTCGAACAAGTGATGGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001039703.2-254s21c1
Sequence:CCGGAGAGTGCAAAGACCTCATAAACTCGAGTTTATGAGGTCTTTGCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039703.2-1632s21c1
Sequence:CCGGGAGGATGCTGTACACATTATTCTCGAGAATAATGTGTACAGCATCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039703.2-2033s21c1
Sequence:CCGGGCCCTACAGCAGTGCTGTTTACTCGAGTAAACAGCACTGCTGTAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039703.2-2493s21c1
Sequence:CCGGTGTTATTCTACTCCGTCAATGCTCGAGCATTGACGGAGTAGAATAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039703
VALIDATED
NBPF10 MISSION shRNA shRNA Plasmid DNA
neuroblastoma breakpoint family, member 10
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001039703.2-1504s21c1
Sequence:CCGGGTGCCATCACTTGTTCGAATACTCGAGTATTCGAACAAGTGATGGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001039703.2-254s21c1
Sequence:CCGGAGAGTGCAAAGACCTCATAAACTCGAGTTTATGAGGTCTTTGCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039703.2-1632s21c1
Sequence:CCGGGAGGATGCTGTACACATTATTCTCGAGAATAATGTGTACAGCATCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039703.2-2033s21c1
Sequence:CCGGGCCCTACAGCAGTGCTGTTTACTCGAGTAAACAGCACTGCTGTAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039703.2-2493s21c1
Sequence:CCGGTGTTATTCTACTCCGTCAATGCTCGAGCATTGACGGAGTAGAATAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039703
VALIDATED
NBPF10 MISSION shRNA Lentiviral Transduction Particles
neuroblastoma breakpoint family, member 10
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001039703.2-1504s21c1
Sequence:CCGGGTGCCATCACTTGTTCGAATACTCGAGTATTCGAACAAGTGATGGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001039703.2-254s21c1
Sequence:CCGGAGAGTGCAAAGACCTCATAAACTCGAGTTTATGAGGTCTTTGCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039703.2-1632s21c1
Sequence:CCGGGAGGATGCTGTACACATTATTCTCGAGAATAATGTGTACAGCATCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039703.2-2033s21c1
Sequence:CCGGGCCCTACAGCAGTGCTGTTTACTCGAGTAAACAGCACTGCTGTAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039703.2-2493s21c1
Sequence:CCGGTGTTATTCTACTCCGTCAATGCTCGAGCATTGACGGAGTAGAATAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)