EMAIL THIS PAGE TO A FRIEND

NBPF14

neuroblastoma breakpoint family, member 14

51 Gene Product Result for
Synonyms: DJ328E19.C1.1 NBPF
Species: Human NBPF14(25832)
UniProtKB ID: Q5TI25, Q5TI23, Q8IX76, Q9UJI9
Gene ID:
Human(25832) Summary: This gene is a member of the neuroblastoma breakpoint family (NBPF) which consists of dozens of recently duplicated genes primarily located in segmental duplications on human chromosome 1. This gene family has experienced its greatest expansion within the human lineage and has expanded, to a lesser extent, among primates in general. Members of this gene family are characterized by tandemly repeated copies of DUF1220 protein domains. Gene copy number variations in the human chromosomal region 1q21.1, where most DUF1220 domains are located, have been implicated in a number of developmental and neurogenetic diseases such as microcephaly, macrocephaly, autism, schizophrenia, mental retardation, congenital heart disease, neuroblastoma, and congenital kidney and urinary tract anomalies. Altered expression of some gene family members is associated with several types of cancer. This gene family contains numerous pseudogenes. [provided by RefSeq, May 2013]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015383 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015383 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015383 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU153131 MISSION® esiRNA esiRNA human NBPF14 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015383 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015383 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104627 predicted 2841
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015383
VALIDATED
NBPF14 MISSION shRNA Bacterial Glycerol Stock
neuroblastoma breakpoint family, member 14
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015383.1-783s1c1
Sequence:CCGGGCTGTTGACATAGGCAGACATCTCGAGATGTCTGCCTATGTCAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015383.1-318s1c1
Sequence:CCGGGACGATGAAGATGTTCAAGTTCTCGAGAACTTGAACATCTTCATCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163889    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015383.1-3536s1c1
Sequence:CCGGCCTGAGTTTCATAGGAGGTAACTCGAGTTACCTCCTATGAAACTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015383.1-1965s1c1
Sequence:CCGGGCTGTTGACATGGATGAAATTCTCGAGAATTTCATCCATGTCAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159594    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015383.1-1008s1c1
Sequence:CCGGGCTGTTAACATGGATGAAATTCTCGAGAATTTCATCCATGTTAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015383.1-740s1c1
Sequence:CCGGCAGCAGCACATTTCACTCATTCTCGAGAATGAGTGAAATGTGCTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015383.1-995s21c1
Sequence:CCGGGCGTGTTGGCTTGGCTGTTAACTCGAGTTAACAGCCAAGCCAACACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015383.1-1235s21c1
Sequence:CCGGTCTTGACGTGGACAGAATTAACTCGAGTTAATTCTGTCCACGTCAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015383.1-559s21c1
Sequence:CCGGAGGATGCTGTACACATTATTCCTCGAGGAATAATGTGTACAGCATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015383.1-2778s21c1
Sequence:CCGGCAATAAGCAGCCCTTACTAAGCTCGAGCTTAGTAAGGGCTGCTTATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015383.1-2581s21c1
Sequence:CCGGTGCAGGACTCACTGGATATATCTCGAGATATATCCAGTGAGTCCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015383.1-1122s21c1
Sequence:CCGGGACTCACTGGGTAGATGTTATCTCGAGATAACATCTACCCAGTGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369532    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015383.1-3274s21c1
Sequence:CCGGCACCAACTGCTCTTGACAATTCTCGAGAATTGTCAAGAGCAGTTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015383
VALIDATED
NBPF14 MISSION shRNA shRNA Plasmid DNA
neuroblastoma breakpoint family, member 14
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015383.1-783s1c1
Sequence:CCGGGCTGTTGACATAGGCAGACATCTCGAGATGTCTGCCTATGTCAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015383.1-318s1c1
Sequence:CCGGGACGATGAAGATGTTCAAGTTCTCGAGAACTTGAACATCTTCATCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163889    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015383.1-3536s1c1
Sequence:CCGGCCTGAGTTTCATAGGAGGTAACTCGAGTTACCTCCTATGAAACTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015383.1-1965s1c1
Sequence:CCGGGCTGTTGACATGGATGAAATTCTCGAGAATTTCATCCATGTCAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159594    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015383.1-1008s1c1
Sequence:CCGGGCTGTTAACATGGATGAAATTCTCGAGAATTTCATCCATGTTAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015383.1-740s1c1
Sequence:CCGGCAGCAGCACATTTCACTCATTCTCGAGAATGAGTGAAATGTGCTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015383.1-995s21c1
Sequence:CCGGGCGTGTTGGCTTGGCTGTTAACTCGAGTTAACAGCCAAGCCAACACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015383.1-1235s21c1
Sequence:CCGGTCTTGACGTGGACAGAATTAACTCGAGTTAATTCTGTCCACGTCAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015383.1-559s21c1
Sequence:CCGGAGGATGCTGTACACATTATTCCTCGAGGAATAATGTGTACAGCATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015383.1-2778s21c1
Sequence:CCGGCAATAAGCAGCCCTTACTAAGCTCGAGCTTAGTAAGGGCTGCTTATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015383.1-2581s21c1
Sequence:CCGGTGCAGGACTCACTGGATATATCTCGAGATATATCCAGTGAGTCCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015383.1-1122s21c1
Sequence:CCGGGACTCACTGGGTAGATGTTATCTCGAGATAACATCTACCCAGTGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369532    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015383.1-3274s21c1
Sequence:CCGGCACCAACTGCTCTTGACAATTCTCGAGAATTGTCAAGAGCAGTTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015383
VALIDATED
NBPF14 MISSION shRNA Lentiviral Transduction Particles
neuroblastoma breakpoint family, member 14
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015383.1-783s1c1
Sequence:CCGGGCTGTTGACATAGGCAGACATCTCGAGATGTCTGCCTATGTCAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015383.1-318s1c1
Sequence:CCGGGACGATGAAGATGTTCAAGTTCTCGAGAACTTGAACATCTTCATCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163889    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015383.1-3536s1c1
Sequence:CCGGCCTGAGTTTCATAGGAGGTAACTCGAGTTACCTCCTATGAAACTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015383.1-1965s1c1
Sequence:CCGGGCTGTTGACATGGATGAAATTCTCGAGAATTTCATCCATGTCAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159594    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015383.1-1008s1c1
Sequence:CCGGGCTGTTAACATGGATGAAATTCTCGAGAATTTCATCCATGTTAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015383.1-740s1c1
Sequence:CCGGCAGCAGCACATTTCACTCATTCTCGAGAATGAGTGAAATGTGCTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015383.1-995s21c1
Sequence:CCGGGCGTGTTGGCTTGGCTGTTAACTCGAGTTAACAGCCAAGCCAACACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015383.1-1235s21c1
Sequence:CCGGTCTTGACGTGGACAGAATTAACTCGAGTTAATTCTGTCCACGTCAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015383.1-559s21c1
Sequence:CCGGAGGATGCTGTACACATTATTCCTCGAGGAATAATGTGTACAGCATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015383.1-2778s21c1
Sequence:CCGGCAATAAGCAGCCCTTACTAAGCTCGAGCTTAGTAAGGGCTGCTTATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015383.1-2581s21c1
Sequence:CCGGTGCAGGACTCACTGGATATATCTCGAGATATATCCAGTGAGTCCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015383.1-1122s21c1
Sequence:CCGGGACTCACTGGGTAGATGTTATCTCGAGATAACATCTACCCAGTGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369532    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015383.1-3274s21c1
Sequence:CCGGCACCAACTGCTCTTGACAATTCTCGAGAATTGTCAAGAGCAGTTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)