EMAIL THIS PAGE TO A FRIEND

NBPF15

neuroblastoma breakpoint family, member 15

66 Gene Product Result for
Synonyms: AB14
Species: Human NBPF15(284565)
UniProtKB ID: Q8N660, Q3BBV9, Q8IX77
Gene ID:
Human(284565) Summary: This gene is a member of the neuroblastoma breakpoint family (NBPF) which consists of dozens of recently duplicated genes primarily located in segmental duplications on human chromosome 1. This gene family has experienced its greatest expansion within the human lineage and has expanded, to a lesser extent, among primates in general. Members of this gene family are characterized by tandemly repeated copies of DUF1220 protein domains. Gene copy number variations in the human chromosomal region 1q21.1, where most DUF1220 domains are located, have been implicated in a number of developmental and neurogenetic diseases such as microcephaly, macrocephaly, autism, schizophrenia, mental retardation, congenital heart disease, neuroblastoma, and congenital kidney and urinary tract anomalies. Altered expression of some gene family members is associated with several types of cancer. This gene family contains numerous pseudogenes. [provided by RefSeq, May 2013]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA043105 Anti-NBPF15 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173638 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173638 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173638 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173638 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173638 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117096 predicted 2540
2 SASI_Hs01_00117097 predicted 2563
3 SASI_Hs01_00117095 predicted 2547
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173638
VALIDATED
NBPF15 MISSION shRNA Bacterial Glycerol Stock
neuroblastoma breakpoint family, member 15
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173638.2-1915s21c1
Sequence:CCGGCTTGCCGTGGACAGAATTAAACTCGAGTTTAATTCTGTCCACGGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173638.2-2332s1c1
Sequence:CCGGCCGTCAATGTACTTTGAACAACTCGAGTTGTTCAAAGTACATTGACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146474    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173638.2-3255s1c1
Sequence:CCGGCCTGAGTTTCATAGGAGGTAACTCGAGTTACCTCCTATGAAACTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173638.2-2320s21c1
Sequence:CCGGTGTTATTCGACTCCGTCAATGCTCGAGCATTGACGGAGTCGAATAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173638.2-2414s21c1
Sequence:CCGGTCGCCCTTTACGTGGACAATACTCGAGTATTGTCCACGTAAAGGGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173638.2-2472s21c1
Sequence:CCGGGTTCCAGATGGGAGTCATATTCTCGAGAATATGACTCCCATCTGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173638.2-994s1c1
Sequence:CCGGGATGACGATGAAGATGTTCAACTCGAGTTGAACATCTTCATCGTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127801    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173638.2-3601s1c1
Sequence:CCGGGCAGAGACAATGCTGTGAGTTCTCGAGAACTCACAGCATTGTCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173638.2-2470s1c1
Sequence:CCGGGTGTTCCAGATGGGAGTCATACTCGAGTATGACTCCCATCTGGAACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173638.2-2810s21c1
Sequence:CCGGGCATGTCTCTGAGCTTCTATACTCGAGTATAGAAGCTCAGAGACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173638
VALIDATED
NBPF15 MISSION shRNA shRNA Plasmid DNA
neuroblastoma breakpoint family, member 15
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173638.2-1915s21c1
Sequence:CCGGCTTGCCGTGGACAGAATTAAACTCGAGTTTAATTCTGTCCACGGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173638.2-2332s1c1
Sequence:CCGGCCGTCAATGTACTTTGAACAACTCGAGTTGTTCAAAGTACATTGACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146474    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173638.2-3255s1c1
Sequence:CCGGCCTGAGTTTCATAGGAGGTAACTCGAGTTACCTCCTATGAAACTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173638.2-2320s21c1
Sequence:CCGGTGTTATTCGACTCCGTCAATGCTCGAGCATTGACGGAGTCGAATAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173638.2-2414s21c1
Sequence:CCGGTCGCCCTTTACGTGGACAATACTCGAGTATTGTCCACGTAAAGGGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173638.2-2472s21c1
Sequence:CCGGGTTCCAGATGGGAGTCATATTCTCGAGAATATGACTCCCATCTGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173638.2-994s1c1
Sequence:CCGGGATGACGATGAAGATGTTCAACTCGAGTTGAACATCTTCATCGTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127801    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173638.2-3601s1c1
Sequence:CCGGGCAGAGACAATGCTGTGAGTTCTCGAGAACTCACAGCATTGTCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173638.2-2470s1c1
Sequence:CCGGGTGTTCCAGATGGGAGTCATACTCGAGTATGACTCCCATCTGGAACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173638.2-2810s21c1
Sequence:CCGGGCATGTCTCTGAGCTTCTATACTCGAGTATAGAAGCTCAGAGACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173638
VALIDATED
NBPF15 MISSION shRNA Lentiviral Transduction Particles
neuroblastoma breakpoint family, member 15
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173638.2-1915s21c1
Sequence:CCGGCTTGCCGTGGACAGAATTAAACTCGAGTTTAATTCTGTCCACGGCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173638.2-2332s1c1
Sequence:CCGGCCGTCAATGTACTTTGAACAACTCGAGTTGTTCAAAGTACATTGACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146474    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173638.2-3255s1c1
Sequence:CCGGCCTGAGTTTCATAGGAGGTAACTCGAGTTACCTCCTATGAAACTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173638.2-2320s21c1
Sequence:CCGGTGTTATTCGACTCCGTCAATGCTCGAGCATTGACGGAGTCGAATAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173638.2-2414s21c1
Sequence:CCGGTCGCCCTTTACGTGGACAATACTCGAGTATTGTCCACGTAAAGGGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173638.2-2472s21c1
Sequence:CCGGGTTCCAGATGGGAGTCATATTCTCGAGAATATGACTCCCATCTGGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173638.2-994s1c1
Sequence:CCGGGATGACGATGAAGATGTTCAACTCGAGTTGAACATCTTCATCGTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127801    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173638.2-3601s1c1
Sequence:CCGGGCAGAGACAATGCTGTGAGTTCTCGAGAACTCACAGCATTGTCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173638.2-2470s1c1
Sequence:CCGGGTGTTCCAGATGGGAGTCATACTCGAGTATGACTCCCATCTGGAACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173638.2-2810s21c1
Sequence:CCGGGCATGTCTCTGAGCTTCTATACTCGAGTATAGAAGCTCAGAGACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)