EMAIL THIS PAGE TO A FRIEND

NBPF16

neuroblastoma breakpoint family, member 16

4 Gene Product Result for
Synonyms: AG3
Species: Human NBPF16(728936)
UniProtKB ID: Q5SXJ2, A8MPT6
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001102663 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001102663 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001102663 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001102663 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102663 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323490 predicted 2244
2 SASI_Hs02_00323491 predicted 2263
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001102663
NBPF16 MISSION shRNA Bacterial Glycerol Stock
neuroblastoma breakpoint family, member 16
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102663.1-2105s21c1
Sequence:CCGGGCATATCAGCTTCGCCCTTTACTCGAGTAAAGGGCGAAGCTGATATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102663.1-2173s21c1
Sequence:CCGGTGTTCCAGATGGGAGTCATATCTCGAGATATGACTCCCATCTGGAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001102663.1-3358s21c1
Sequence:CCGGTAGTTTGTCCATCACCATTATCTCGAGATAATGGTGATGGACAAACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102663.1-1522s21c1
Sequence:CCGGATTCGACTCCTTCAGATTATCCTCGAGGATAATCTGAAGGAGTCGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102663.1-459s21c1
Sequence:CCGGGAGGAGCTCAGGCAATATAAACTCGAGTTTATATTGCCTGAGCTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001102663
NBPF16 MISSION shRNA shRNA Plasmid DNA
neuroblastoma breakpoint family, member 16
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102663.1-2105s21c1
Sequence:CCGGGCATATCAGCTTCGCCCTTTACTCGAGTAAAGGGCGAAGCTGATATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102663.1-2173s21c1
Sequence:CCGGTGTTCCAGATGGGAGTCATATCTCGAGATATGACTCCCATCTGGAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001102663.1-3358s21c1
Sequence:CCGGTAGTTTGTCCATCACCATTATCTCGAGATAATGGTGATGGACAAACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102663.1-1522s21c1
Sequence:CCGGATTCGACTCCTTCAGATTATCCTCGAGGATAATCTGAAGGAGTCGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102663.1-459s21c1
Sequence:CCGGGAGGAGCTCAGGCAATATAAACTCGAGTTTATATTGCCTGAGCTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001102663
NBPF16 MISSION shRNA Lentiviral Transduction Particles
neuroblastoma breakpoint family, member 16
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102663.1-2105s21c1
Sequence:CCGGGCATATCAGCTTCGCCCTTTACTCGAGTAAAGGGCGAAGCTGATATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102663.1-2173s21c1
Sequence:CCGGTGTTCCAGATGGGAGTCATATCTCGAGATATGACTCCCATCTGGAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001102663.1-3358s21c1
Sequence:CCGGTAGTTTGTCCATCACCATTATCTCGAGATAATGGTGATGGACAAACTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102663.1-1522s21c1
Sequence:CCGGATTCGACTCCTTCAGATTATCCTCGAGGATAATCTGAAGGAGTCGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102663.1-459s21c1
Sequence:CCGGGAGGAGCTCAGGCAATATAAACTCGAGTTTATATTGCCTGAGCTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)