EMAIL THIS PAGE TO A FRIEND

NBPF1

neuroblastoma breakpoint family, member 1

5 Gene Product Result for
Synonyms: AB13 AB14 AB23 AD2 NBG NBPF
Species: Human NBPF1(55672)
UniProtKB ID: Q3BBV0, Q8N4E8, Q9C0H0
Gene ID:
Human(55672) Summary: This gene is a member of the neuroblastoma breakpoint family (NBPF) which consists of dozens of recently duplicated genes primarily located in segmental duplications on human chromosome 1. This gene family has experienced its greatest expansion within the human lineage and has expanded, to a lesser extent, among primates in general. Members of this gene family are characterized by tandemly repeated copies of DUF1220 protein domains. Gene copy number variations in the human chromosomal region 1q21.1, where most DUF1220 domains are located, have been implicated in a number of developmental and neurogenetic diseases such as microcephaly, macrocephaly, autism, schizophrenia, mental retardation, congenital heart disease, neuroblastoma, and congenital kidney and urinary tract anomalies. Altered expression of some gene family members is associated with several types of cancer. This gene family contains numerous pseudogenes. [provided by RefSeq, Apr 2013]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501082 Anti-NBPF1 antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017940 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017940 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017940 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017940 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017940 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229527 predicted 3007
2 SASI_Hs01_00229528 predicted 4555
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017940
NBPF1 MISSION shRNA Bacterial Glycerol Stock
neuroblastoma breakpoint family, member 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017940.3-3445s21c1
Sequence:CCGGAGCGGCACATTTCACTCATTACTCGAGTAATGAGTGAAATGTGCCGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017940.3-3635s21c1
Sequence:CCGGGTTATCTTGAACTGACCGACTCTCGAGAGTCGGTCAGTTCAAGATAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017940.3-3011s21c1
Sequence:CCGGATGACAATGATCACGATGAAGCTCGAGCTTCATCGTGATCATTGTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166733    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017940.1-1115s1c1
Sequence:CCGGCAAGTCTTACAGCGGCACATTCTCGAGAATGTGCCGCTGTAAGACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017940.1-814s1c1
Sequence:CCGGGTGCCATCACTTGTTCAAATACTCGAGTATTTGAACAAGTGATGGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017940.1-2016s1c1
Sequence:CCGGGACTCACTGGATAGATGTTATCTCGAGATAACATCTATCCAGTGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017940.1-1392s1c1
Sequence:CCGGGCTCTTGACATGGATGAAATTCTCGAGAATTTCATCCATGTCAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017940.1-1581s1c1
Sequence:CCGGGCTGTTTACTCATTGGAGGAACTCGAGTTCCTCCAATGAGTAAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017940.1-2181s1c1
Sequence:CCGGGTCTTCCAGATGGGAGTCATACTCGAGTATGACTCCCATCTGGAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017940
NBPF1 MISSION shRNA shRNA Plasmid DNA
neuroblastoma breakpoint family, member 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017940.3-3445s21c1
Sequence:CCGGAGCGGCACATTTCACTCATTACTCGAGTAATGAGTGAAATGTGCCGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017940.3-3635s21c1
Sequence:CCGGGTTATCTTGAACTGACCGACTCTCGAGAGTCGGTCAGTTCAAGATAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017940.3-3011s21c1
Sequence:CCGGATGACAATGATCACGATGAAGCTCGAGCTTCATCGTGATCATTGTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166733    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017940.1-1115s1c1
Sequence:CCGGCAAGTCTTACAGCGGCACATTCTCGAGAATGTGCCGCTGTAAGACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017940.1-814s1c1
Sequence:CCGGGTGCCATCACTTGTTCAAATACTCGAGTATTTGAACAAGTGATGGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017940.1-2016s1c1
Sequence:CCGGGACTCACTGGATAGATGTTATCTCGAGATAACATCTATCCAGTGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017940.1-1392s1c1
Sequence:CCGGGCTCTTGACATGGATGAAATTCTCGAGAATTTCATCCATGTCAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017940.1-1581s1c1
Sequence:CCGGGCTGTTTACTCATTGGAGGAACTCGAGTTCCTCCAATGAGTAAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017940.1-2181s1c1
Sequence:CCGGGTCTTCCAGATGGGAGTCATACTCGAGTATGACTCCCATCTGGAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017940
NBPF1 MISSION shRNA Lentiviral Transduction Particles
neuroblastoma breakpoint family, member 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017940.3-3445s21c1
Sequence:CCGGAGCGGCACATTTCACTCATTACTCGAGTAATGAGTGAAATGTGCCGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017940.3-3635s21c1
Sequence:CCGGGTTATCTTGAACTGACCGACTCTCGAGAGTCGGTCAGTTCAAGATAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017940.3-3011s21c1
Sequence:CCGGATGACAATGATCACGATGAAGCTCGAGCTTCATCGTGATCATTGTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166733    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017940.1-1115s1c1
Sequence:CCGGCAAGTCTTACAGCGGCACATTCTCGAGAATGTGCCGCTGTAAGACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017940.1-814s1c1
Sequence:CCGGGTGCCATCACTTGTTCAAATACTCGAGTATTTGAACAAGTGATGGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017940.1-2016s1c1
Sequence:CCGGGACTCACTGGATAGATGTTATCTCGAGATAACATCTATCCAGTGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017940.1-1392s1c1
Sequence:CCGGGCTCTTGACATGGATGAAATTCTCGAGAATTTCATCCATGTCAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017940.1-1581s1c1
Sequence:CCGGGCTGTTTACTCATTGGAGGAACTCGAGTTCCTCCAATGAGTAAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017940.1-2181s1c1
Sequence:CCGGGTCTTCCAGATGGGAGTCATACTCGAGTATGACTCCCATCTGGAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)