EMAIL THIS PAGE TO A FRIEND

NBPF24

neuroblastoma breakpoint family, member 24

98 Gene Product Result for
Species: Human NBPF24(728912)
UniProtKB ID: Q5RGN0
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001101663 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001101663 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001101663 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001101663 Rosetta Predictions human pricing
XM_001721349 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101663 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322899 predicted 701
2 SASI_Hs02_00322900 predicted 697
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001721349 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00442330 predicted 531
2 SASI_Hs02_00442331 predicted 363
3 SASI_Hs02_00442332 predicted 523
4 SASI_Hs02_00442333 predicted 521
5 SASI_Hs02_00442334 predicted 361
6 SASI_Hs02_00442335 predicted 353
7 SASI_Hs02_00442336 predicted 366
8 SASI_Hs02_00442337 predicted 532
9 SASI_Hs02_00442338 predicted 513
10 SASI_Hs02_00442339 predicted 362
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001101663
NBPF24 MISSION shRNA Bacterial Glycerol Stock
neuroblastoma breakpoint family, member 24
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101663.1-2677s21c1
Sequence:CCGGCTTGACGTGGACAGAATTAAACTCGAGTTTAATTCTGTCCACGTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101663.1-1057s21c1
Sequence:CCGGTGTGCCATCACTTGTTCAAATCTCGAGATTTGAACAAGTGATGGCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101663.1-2422s21c1
Sequence:CCGGGTATTGGAGCAACAGCGTATTCTCGAGAATACGCTGTTGCTCCAATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244547    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101663.1-3234s21c1
Sequence:CCGGTTCCAGATGGGAGTCATATTCCTCGAGGAATATGACTCCCATCTGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101663.1-2114s21c1
Sequence:CCGGAGTCCTGGGATGAAGGTTATTCTCGAGAATAACCTTCATCCCAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001101663
NBPF24 MISSION shRNA shRNA Plasmid DNA
neuroblastoma breakpoint family, member 24
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101663.1-2677s21c1
Sequence:CCGGCTTGACGTGGACAGAATTAAACTCGAGTTTAATTCTGTCCACGTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101663.1-1057s21c1
Sequence:CCGGTGTGCCATCACTTGTTCAAATCTCGAGATTTGAACAAGTGATGGCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101663.1-2422s21c1
Sequence:CCGGGTATTGGAGCAACAGCGTATTCTCGAGAATACGCTGTTGCTCCAATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244547    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101663.1-3234s21c1
Sequence:CCGGTTCCAGATGGGAGTCATATTCCTCGAGGAATATGACTCCCATCTGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101663.1-2114s21c1
Sequence:CCGGAGTCCTGGGATGAAGGTTATTCTCGAGAATAACCTTCATCCCAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001101663
NBPF24 MISSION shRNA Lentiviral Transduction Particles
neuroblastoma breakpoint family, member 24
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101663.1-2677s21c1
Sequence:CCGGCTTGACGTGGACAGAATTAAACTCGAGTTTAATTCTGTCCACGTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101663.1-1057s21c1
Sequence:CCGGTGTGCCATCACTTGTTCAAATCTCGAGATTTGAACAAGTGATGGCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101663.1-2422s21c1
Sequence:CCGGGTATTGGAGCAACAGCGTATTCTCGAGAATACGCTGTTGCTCCAATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244547    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101663.1-3234s21c1
Sequence:CCGGTTCCAGATGGGAGTCATATTCCTCGAGGAATATGACTCCCATCTGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101663.1-2114s21c1
Sequence:CCGGAGTCCTGGGATGAAGGTTATTCTCGAGAATAACCTTCATCCCAGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)