EMAIL THIS PAGE TO A FRIEND

NBPF3

neuroblastoma breakpoint family, member 3

127 Gene Product Result for
Synonyms: AE2
Species: Human NBPF3(84224)
Gene ID:
Human(84224) Summary: This gene is a member of the neuroblastoma breakpoint family (NBPF) which consists of dozens of recently duplicated genes primarily located in segmental duplications on human chromosome 1. This gene family has experienced its greatest expansion within the human lineage and has expanded, to a lesser extent, among primates in general. Members of this gene family are characterized by tandemly repeated copies of DUF1220 protein domains. DUF1220 copy number variations in human chromosomal region 1q21.1, where most DUF1220 domains are located, have been implicated in a number of developmental and neurogenetic diseases such as microcephaly, macrocephaly, autism, schizophrenia, mental retardation, congenital heart disease, neuroblastoma, and congenital kidney and urinary tract anomalies. Altered expression of some gene family members is associated with several types of cancer. This gene family contains numerous pseudogenes. [provided by RefSeq, Feb 2013]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032264 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032264 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032264 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032264 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032264 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062115 predicted 1387
2 SASI_Hs01_00062119 predicted 1260
3 SASI_Hs01_00062120 predicted 1390
4 SASI_Hs01_00062122 predicted 2107
5 SASI_Hs02_00359571 predicted 2291
6 SASI_Hs01_00062124 predicted 1414
7 SASI_Hs01_00062116 predicted 1843
8 SASI_Hs01_00062117 predicted 1054
9 SASI_Hs01_00062118 predicted 2089
10 SASI_Hs01_00062121 predicted 1051
11 SASI_Hs01_00062123 predicted 631
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032264
VALIDATED
NBPF3 MISSION shRNA Bacterial Glycerol Stock
neuroblastoma breakpoint family, member 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032264.2-2011s21c1
Sequence:CCGGTCAACGAGGTGCTGATGGAAGCTCGAGCTTCCATCAGCACCTCGTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032264.2-1854s21c1
Sequence:CCGGACTCCTTTCAGTTATCCAGAACTCGAGTTCTGGATAACTGAAAGGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032264.2-2073s21c1
Sequence:CCGGTATTCGACTACTTCAACTTACCTCGAGGTAAGTTGAAGTAGTCGAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412528    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032264.2-2484s21c1
Sequence:CCGGTGATCTGCCAGACATTCTAATCTCGAGATTAGAATGTCTGGCAGATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032264.2-2246s21c1
Sequence:CCGGACACTAAGCAGCCCTTACTAACTCGAGTTAGTAAGGGCTGCTTAGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032264.1-1426s1c1
Sequence:CCGGGCAGGACTCACTGGATAGATTCTCGAGAATCTATCCAGTGAGTCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032264.1-1745s1c1
Sequence:CCGGGAGGAAGAACACGTTGGCTTTCTCGAGAAAGCCAACGTGTTCTTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032264.1-524s1c1
Sequence:CCGGGAAGACTGCAAAGACCTCATACTCGAGTATGAGGTCTTTGCAGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172709    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032264.1-1316s1c1
Sequence:CCGGGCTCTTGACATAGGCAGACATCTCGAGATGTCTGCCTATGTCAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032264
VALIDATED
NBPF3 MISSION shRNA shRNA Plasmid DNA
neuroblastoma breakpoint family, member 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032264.2-2011s21c1
Sequence:CCGGTCAACGAGGTGCTGATGGAAGCTCGAGCTTCCATCAGCACCTCGTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032264.2-1854s21c1
Sequence:CCGGACTCCTTTCAGTTATCCAGAACTCGAGTTCTGGATAACTGAAAGGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032264.2-2073s21c1
Sequence:CCGGTATTCGACTACTTCAACTTACCTCGAGGTAAGTTGAAGTAGTCGAATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412528    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032264.2-2484s21c1
Sequence:CCGGTGATCTGCCAGACATTCTAATCTCGAGATTAGAATGTCTGGCAGATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032264.2-2246s21c1
Sequence:CCGGACACTAAGCAGCCCTTACTAACTCGAGTTAGTAAGGGCTGCTTAGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032264.1-1426s1c1
Sequence:CCGGGCAGGACTCACTGGATAGATTCTCGAGAATCTATCCAGTGAGTCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032264.1-1745s1c1
Sequence:CCGGGAGGAAGAACACGTTGGCTTTCTCGAGAAAGCCAACGTGTTCTTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032264.1-524s1c1
Sequence:CCGGGAAGACTGCAAAGACCTCATACTCGAGTATGAGGTCTTTGCAGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172709    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032264.1-1316s1c1
Sequence:CCGGGCTCTTGACATAGGCAGACATCTCGAGATGTCTGCCTATGTCAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032264
VALIDATED
NBPF3 MISSION shRNA Lentiviral Transduction Particles
neuroblastoma breakpoint family, member 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032264.2-2011s21c1
Sequence:CCGGTCAACGAGGTGCTGATGGAAGCTCGAGCTTCCATCAGCACCTCGTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032264.2-1854s21c1
Sequence:CCGGACTCCTTTCAGTTATCCAGAACTCGAGTTCTGGATAACTGAAAGGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032264.2-2073s21c1
Sequence:CCGGTATTCGACTACTTCAACTTACCTCGAGGTAAGTTGAAGTAGTCGAATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412528    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032264.2-2484s21c1
Sequence:CCGGTGATCTGCCAGACATTCTAATCTCGAGATTAGAATGTCTGGCAGATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032264.2-2246s21c1
Sequence:CCGGACACTAAGCAGCCCTTACTAACTCGAGTTAGTAAGGGCTGCTTAGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032264.1-1426s1c1
Sequence:CCGGGCAGGACTCACTGGATAGATTCTCGAGAATCTATCCAGTGAGTCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032264.1-1745s1c1
Sequence:CCGGGAGGAAGAACACGTTGGCTTTCTCGAGAAAGCCAACGTGTTCTTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032264.1-524s1c1
Sequence:CCGGGAAGACTGCAAAGACCTCATACTCGAGTATGAGGTCTTTGCAGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172709    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032264.1-1316s1c1
Sequence:CCGGGCTCTTGACATAGGCAGACATCTCGAGATGTCTGCCTATGTCAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)