EMAIL THIS PAGE TO A FRIEND

NBPF4

neuroblastoma breakpoint family, member 4

19 Gene Product Result for
Species: Human NBPF4(148545)
UniProtKB ID: Q96M43, Q5T483
Gene ID:
Human(148545) Summary: This gene is a member of the neuroblastoma breakpoint family (NBPF) which consists of dozens of recently duplicated genes primarily located in segmental duplications on human chromosome 1. This gene family has experienced its greatest expansion within the human lineage and has expanded, to a lesser extent, among primates in general. Members of this gene family are characterized by tandemly repeated copies of DUF1220 protein domains. Gene copy number variations in the human chromosomal region 1q21.1, where most DUF1220 domains are located, have been implicated in a number of developmental and neurogenetic diseases such as microcephaly, macrocephaly, autism, schizophrenia, mental retardation, congenital heart disease, neuroblastoma, and congenital kidney and urinary tract anomalies. Altered expression of some gene family members is associated with several types of cancer. This gene family contains numerous pseudogenes. [provided by RefSeq, Mar 2013]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152488 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152488 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152488 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001143989 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001143989 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001143989 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152488 Rosetta Predictions human pricing
XR_040171 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152488 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135754 predicted 522
2 SASI_Hs01_00135755 predicted 364
3 SASI_Hs01_00135756 predicted 755
4 SASI_Hs01_00135757 predicted 775
5 SASI_Hs01_00135758 predicted 791
6 SASI_Hs01_00135759 predicted 446
7 SASI_Hs01_00135760 predicted 761
8 SASI_Hs01_00135761 predicted 663
9 SASI_Hs01_00135762 predicted 703
10 SASI_Hs01_00135763 predicted 451
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040171 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00516568 predicted 1175
2 SASI_Hs02_00516569 predicted 1190
3 SASI_Hs02_00516570 predicted 844
4 SASI_Hs02_00516571 predicted 1158
5 SASI_Hs02_00516572 predicted 1069
6 SASI_Hs02_00516573 predicted 1866
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152488
NBPF4 MISSION shRNA Bacterial Glycerol Stock
neuroblastoma breakpoint family, member 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152488.1-225s1c1
Sequence:CCGGGCAGAGATGAACATCCTAGAACTCGAGTTCTAGGATGTTCATCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167427    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152488.1-230s1c1
Sequence:CCGGGATGAACATCCTAGAAATCAACTCGAGTTGATTTCTAGGATGTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152488.1-460s1c1
Sequence:CCGGCACTTGTTCAAATAGTCACAACTCGAGTTGTGACTATTTGAACAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167380    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152488.1-359s1c1
Sequence:CCGGGAAATACAAGTGTGAAGAGTACTCGAGTACTCTTCACACTTGTATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152488.1-365s1c1
Sequence:CCGGCAAGTGTGAAGAGTACAGGAACTCGAGTTCCTGTACTCTTCACACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152488
NBPF4 MISSION shRNA shRNA Plasmid DNA
neuroblastoma breakpoint family, member 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152488.1-225s1c1
Sequence:CCGGGCAGAGATGAACATCCTAGAACTCGAGTTCTAGGATGTTCATCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167427    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152488.1-230s1c1
Sequence:CCGGGATGAACATCCTAGAAATCAACTCGAGTTGATTTCTAGGATGTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152488.1-460s1c1
Sequence:CCGGCACTTGTTCAAATAGTCACAACTCGAGTTGTGACTATTTGAACAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167380    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152488.1-359s1c1
Sequence:CCGGGAAATACAAGTGTGAAGAGTACTCGAGTACTCTTCACACTTGTATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152488.1-365s1c1
Sequence:CCGGCAAGTGTGAAGAGTACAGGAACTCGAGTTCCTGTACTCTTCACACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152488
NBPF4 MISSION shRNA Lentiviral Transduction Particles
neuroblastoma breakpoint family, member 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152488.1-225s1c1
Sequence:CCGGGCAGAGATGAACATCCTAGAACTCGAGTTCTAGGATGTTCATCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167427    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152488.1-230s1c1
Sequence:CCGGGATGAACATCCTAGAAATCAACTCGAGTTGATTTCTAGGATGTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152488.1-460s1c1
Sequence:CCGGCACTTGTTCAAATAGTCACAACTCGAGTTGTGACTATTTGAACAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167380    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152488.1-359s1c1
Sequence:CCGGGAAATACAAGTGTGAAGAGTACTCGAGTACTCTTCACACTTGTATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152488.1-365s1c1
Sequence:CCGGCAAGTGTGAAGAGTACAGGAACTCGAGTTCCTGTACTCTTCACACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001143989
NBPF4 MISSION shRNA Bacterial Glycerol Stock
neuroblastoma breakpoint family, member 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143989.2-2115s21c1
Sequence:CCGGACGCAAAGGATGGCAGGATGACTCGAGTCATCCTGCCATCCTTTGCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143989.2-1696s21c1
Sequence:CCGGACCAGTCAGAGGTGCAAGTTTCTCGAGAAACTTGCACCTCTGACTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143989.2-2084s21c1
Sequence:CCGGGAGCGCAGAGATACCAAATACCTCGAGGTATTTGGTATCTCTGCGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420438    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001143989.2-2183s21c1
Sequence:CCGGACAGCAAAGCAAGTTTAAGTCCTCGAGGACTTAAACTTGCTTTGCTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001143989.2-2195s21c1
Sequence:CCGGGTTTAAGTCCAAACACAATACCTCGAGGTATTGTGTTTGGACTTAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001143989
NBPF4 MISSION shRNA shRNA Plasmid DNA
neuroblastoma breakpoint family, member 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143989.2-2115s21c1
Sequence:CCGGACGCAAAGGATGGCAGGATGACTCGAGTCATCCTGCCATCCTTTGCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143989.2-1696s21c1
Sequence:CCGGACCAGTCAGAGGTGCAAGTTTCTCGAGAAACTTGCACCTCTGACTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143989.2-2084s21c1
Sequence:CCGGGAGCGCAGAGATACCAAATACCTCGAGGTATTTGGTATCTCTGCGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420438    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001143989.2-2183s21c1
Sequence:CCGGACAGCAAAGCAAGTTTAAGTCCTCGAGGACTTAAACTTGCTTTGCTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001143989.2-2195s21c1
Sequence:CCGGGTTTAAGTCCAAACACAATACCTCGAGGTATTGTGTTTGGACTTAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001143989
NBPF4 MISSION shRNA Lentiviral Transduction Particles
neuroblastoma breakpoint family, member 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143989.2-2115s21c1
Sequence:CCGGACGCAAAGGATGGCAGGATGACTCGAGTCATCCTGCCATCCTTTGCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143989.2-1696s21c1
Sequence:CCGGACCAGTCAGAGGTGCAAGTTTCTCGAGAAACTTGCACCTCTGACTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143989.2-2084s21c1
Sequence:CCGGGAGCGCAGAGATACCAAATACCTCGAGGTATTTGGTATCTCTGCGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420438    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001143989.2-2183s21c1
Sequence:CCGGACAGCAAAGCAAGTTTAAGTCCTCGAGGACTTAAACTTGCTTTGCTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001143989.2-2195s21c1
Sequence:CCGGGTTTAAGTCCAAACACAATACCTCGAGGTATTGTGTTTGGACTTAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)