EMAIL THIS PAGE TO A FRIEND

NBPF6

neuroblastoma breakpoint family, member 6

19 Gene Product Result for
Species: Human NBPF6(653149)
UniProtKB ID: Q5VWK0
Gene ID:
Human(653149) Summary: This gene is a member of the neuroblastoma breakpoint family (NBPF) which consists of dozens of recently duplicated genes primarily located in segmental duplications on human chromosome 1. This gene family has experienced its greatest expansion within the human lineage and has expanded, to a lesser extent, among primates in general. Members of this gene family are characterized by tandemly repeated copies of DUF1220 protein domains. Gene copy number variations in the human chromosomal region 1q21.1, where most DUF1220 domains are located, have been implicated in a number of developmental and neurogenetic diseases such as microcephaly, macrocephaly, autism, schizophrenia, mental retardation, congenital heart disease, neuroblastoma, and congenital kidney and urinary tract anomalies. Altered expression of some gene family members is associated with several types of cancer. This gene family contains numerous pseudogenes. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Mar 2013]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001143987 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001143987 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001143987 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_926213 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_926213 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00260376 predicted 1509
2 SASI_Hs02_00480320 predicted 1132
3 SASI_Hs01_00260381 predicted 1152
4 SASI_Hs01_00260382 predicted 1170
5 SASI_Hs01_00260384 predicted 1347
6 SASI_Hs01_00260385 predicted 1508
7 SASI_Hs02_00480321 predicted 1413
8 SASI_Hs02_00480322 predicted 1690
9 SASI_Hs02_00480323 predicted 824
10 SASI_Hs02_00480324 predicted 1136
11 SASI_Hs01_00260377 predicted 2413
12 SASI_Hs01_00260378 predicted 2339
13 SASI_Hs01_00260379 predicted 2147
14 SASI_Hs01_00260380 predicted 1837
15 SASI_Hs01_00260383 predicted 2411
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001143987
NBPF6 MISSION shRNA Bacterial Glycerol Stock
neuroblastoma breakpoint family, member 6
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143987.1-1130s21c1
Sequence:CCGGGGCTAATCCAGGACACCATGACTCGAGTCATGGTGTCCTGGATTAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143987.1-1430s21c1
Sequence:CCGGTCCCTCCTACCACCCTTATTGCTCGAGCAATAAGGGTGGTAGGAGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143987.1-1084s21c1
Sequence:CCGGTGACCAACCTCAGGGATTTCCCTCGAGGGAAATCCCTGAGGTTGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143987.1-730s21c1
Sequence:CCGGATGAGGATGAAGACGACAAAGCTCGAGCTTTGTCGTCTTCATCCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143987.1-486s21c1
Sequence:CCGGGAGGAGCTCAGGCAGTATAAACTCGAGTTTATACTGCCTGAGCTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001143987
NBPF6 MISSION shRNA shRNA Plasmid DNA
neuroblastoma breakpoint family, member 6
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143987.1-1130s21c1
Sequence:CCGGGGCTAATCCAGGACACCATGACTCGAGTCATGGTGTCCTGGATTAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143987.1-1430s21c1
Sequence:CCGGTCCCTCCTACCACCCTTATTGCTCGAGCAATAAGGGTGGTAGGAGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143987.1-1084s21c1
Sequence:CCGGTGACCAACCTCAGGGATTTCCCTCGAGGGAAATCCCTGAGGTTGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143987.1-730s21c1
Sequence:CCGGATGAGGATGAAGACGACAAAGCTCGAGCTTTGTCGTCTTCATCCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143987.1-486s21c1
Sequence:CCGGGAGGAGCTCAGGCAGTATAAACTCGAGTTTATACTGCCTGAGCTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001143987
NBPF6 MISSION shRNA Lentiviral Transduction Particles
neuroblastoma breakpoint family, member 6
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143987.1-1130s21c1
Sequence:CCGGGGCTAATCCAGGACACCATGACTCGAGTCATGGTGTCCTGGATTAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143987.1-1430s21c1
Sequence:CCGGTCCCTCCTACCACCCTTATTGCTCGAGCAATAAGGGTGGTAGGAGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143987.1-1084s21c1
Sequence:CCGGTGACCAACCTCAGGGATTTCCCTCGAGGGAAATCCCTGAGGTTGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143987.1-730s21c1
Sequence:CCGGATGAGGATGAAGACGACAAAGCTCGAGCTTTGTCGTCTTCATCCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143987.1-486s21c1
Sequence:CCGGGAGGAGCTCAGGCAGTATAAACTCGAGTTTATACTGCCTGAGCTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)