EMAIL THIS PAGE TO A FRIEND

NBPF7

neuroblastoma breakpoint family, member 7

26 Gene Product Result for
Species: Human NBPF7(343505)
UniProtKB ID: P0C2Y1
Gene ID:
Human(343505) Summary: This gene is a member of the neuroblastoma breakpoint family (NBPF) which consists of dozens of recently duplicated genes primarily located in segmental duplications on human chromosome 1. This gene family has experienced its greatest expansion within the human lineage and has expanded, to a lesser extent, among primates in general. Members of this gene family are characterized by tandemly repeated copies of DUF1220 protein domains. Gene copy number variations in the human chromosomal region 1q21.1, where most DUF1220 domains are located, have been implicated in a number of developmental and neurogenetic diseases such as microcephaly, macrocephaly, autism, schizophrenia, mental retardation, congenital heart disease, neuroblastoma, and congenital kidney and urinary tract anomalies. Altered expression of some gene family members is associated with several types of cancer. This gene family contains numerous pseudogenes. [provided by RefSeq, Mar 2013]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001047980 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001047980 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001047980 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU118021 MISSION® esiRNA esiRNA human NBPF7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001047980 Rosetta Predictions human pricing
XM_291607 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047980 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311517 predicted 1435
2 SASI_Hs02_00311518 predicted 1515
3 SASI_Hs02_00311519 predicted 1640
4 SASI_Hs02_00311520 predicted 1617
5 SASI_Hs02_00311521 predicted 768
6 SASI_Hs02_00311522 predicted 1507
7 SASI_Hs02_00311523 predicted 1213
8 SASI_Hs02_00311524 predicted 1578
9 SASI_Hs02_00311525 predicted 1610
10 SASI_Hs02_00311526 predicted 1826
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_291607 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00270837 predicted 691
2 SASI_Hs01_00270838 predicted 700
3 SASI_Hs01_00270839 predicted 770
4 SASI_Hs01_00270840 predicted 790
5 SASI_Hs01_00270841 predicted 840
6 SASI_Hs01_00270842 predicted 840
7 SASI_Hs01_00270843 predicted 868
8 SASI_Hs01_00270844 predicted 833
9 SASI_Hs01_00270845 predicted 1933
10 SASI_Hs01_00270846 predicted 938
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001047980
NBPF7 MISSION shRNA Bacterial Glycerol Stock
neuroblastoma breakpoint family, member 7
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001047980.1-1412s21c1
Sequence:CCGGGTGAATCTTCTCAAGATGAATCTCGAGATTCATCTTGAGAAGATTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001047980.1-1509s21c1
Sequence:CCGGCCAGGTAACTCTGTGGATTTGCTCGAGCAAATCCACAGAGTTACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001047980.1-1695s21c1
Sequence:CCGGAGCCAGCGAACACTCCAATTCCTCGAGGAATTGGAGTGTTCGCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001047980.1-1582s21c1
Sequence:CCGGGAGGAAAGGGTTACGACTTCTCTCGAGAGAAGTCGTAACCCTTTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001047980.1-1608s21c1
Sequence:CCGGTGACCATGATGTGTCCCAATCCTCGAGGATTGGGACACATCATGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001047980
NBPF7 MISSION shRNA shRNA Plasmid DNA
neuroblastoma breakpoint family, member 7
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001047980.1-1412s21c1
Sequence:CCGGGTGAATCTTCTCAAGATGAATCTCGAGATTCATCTTGAGAAGATTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001047980.1-1509s21c1
Sequence:CCGGCCAGGTAACTCTGTGGATTTGCTCGAGCAAATCCACAGAGTTACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001047980.1-1695s21c1
Sequence:CCGGAGCCAGCGAACACTCCAATTCCTCGAGGAATTGGAGTGTTCGCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001047980.1-1582s21c1
Sequence:CCGGGAGGAAAGGGTTACGACTTCTCTCGAGAGAAGTCGTAACCCTTTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001047980.1-1608s21c1
Sequence:CCGGTGACCATGATGTGTCCCAATCCTCGAGGATTGGGACACATCATGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001047980
NBPF7 MISSION shRNA Lentiviral Transduction Particles
neuroblastoma breakpoint family, member 7
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001047980.1-1412s21c1
Sequence:CCGGGTGAATCTTCTCAAGATGAATCTCGAGATTCATCTTGAGAAGATTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001047980.1-1509s21c1
Sequence:CCGGCCAGGTAACTCTGTGGATTTGCTCGAGCAAATCCACAGAGTTACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001047980.1-1695s21c1
Sequence:CCGGAGCCAGCGAACACTCCAATTCCTCGAGGAATTGGAGTGTTCGCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001047980.1-1582s21c1
Sequence:CCGGGAGGAAAGGGTTACGACTTCTCTCGAGAGAAGTCGTAACCCTTTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001047980.1-1608s21c1
Sequence:CCGGTGACCATGATGTGTCCCAATCCTCGAGGATTGGGACACATCATGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)