EMAIL THIS PAGE TO A FRIEND

NBR1

neighbor of BRCA1 gene 1

189 Gene Product Result for
Synonyms: 1A1-3B M17S2
UniProtKB ID: Q14596, Q13173, Q15026, Q5J7Q8, Q96GB6, Q9NRF7
Gene ID:
Human(4077) Summary: The protein encoded by this gene was originally identified as an ovarian tumor antigen monitored in ovarian cancer. The encoded protein contains a B-box/coiled coil motif, which is present in many genes with transformation potential, but the function of this protein is unknown. This gene is located on a region of chromosome 17q21.1 that is in close proximity to tumor suppressor gene BRCA1. Three alternatively spliced variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(17966) neighbor of Brca1 gene 1
Rat(303554) neighbor of Brca1 gene 1
Zebrafish(337168) neighbor of brca1 gene 1
chicken(420007) neighbor of BRCA1 gene 1
Horse(100051928) neighbor of BRCA1 gene 1
cow(515032) neighbor of BRCA1 gene 1
domestic cat(101082535) neighbor of BRCA1 gene 1
dog(480509) neighbor of BRCA1 gene 1
sheep(101109026) neighbor of BRCA1 gene 1
domestic guinea pig(100722618) neighbor of BRCA1 gene 1
naked mole-rat(101704622) neighbor of BRCA1 gene 1
Domestic Rabbit(100354979) neighbor of BRCA1 gene 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008676 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008676 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008676 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031858 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031858 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031858 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU116961 MISSION® esiRNA esiRNA human AC109326.11 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005899 Rosetta Predictions human pricing
NM_031858 Rosetta Predictions human pricing
NM_031862 Rosetta Predictions human pricing
NM_001024765 Rosetta Predictions rat pricing
NM_008676 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005899 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169473 predicted 280
2 SASI_Hs01_00169474 predicted 2931
3 SASI_Hs01_00169475 predicted 1209
4 SASI_Hs01_00169477 predicted 744
5 SASI_Hs01_00169478 predicted 2969
6 SASI_Hs01_00169479 predicted 718
7 SASI_Hs01_00169480 predicted 2588
8 SASI_Hs01_00169481 predicted 817
9 SASI_Hs02_00340504 predicted 1756
10 SASI_Hs01_00169482 predicted 2685
11 SASI_Hs01_00169476 predicted 964
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031858 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214810 predicted 656
2 SASI_Hs01_00214811 predicted 3303
3 SASI_Hs01_00214812 predicted 1588
4 SASI_Hs02_00358966 predicted 1328
5 SASI_Hs01_00214813 predicted 1124
6 SASI_Hs01_00214815 predicted 3345
7 SASI_Hs01_00214817 predicted 1090
8 SASI_Hs02_00358967 predicted 1571
9 SASI_Hs01_00214818 predicted 2956
10 SASI_Hs01_00214819 predicted 1191
11 SASI_Hs01_00214814 predicted 638
12 SASI_Hs01_00214816 predicted 551
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031862 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114222 predicted 334
2 SASI_Hs01_00114223 predicted 2982
3 SASI_Hs01_00114224 predicted 1273
4 SASI_Hs01_00114226 predicted 807
5 SASI_Hs01_00114227 predicted 3032
6 SASI_Hs01_00114228 predicted 770
7 SASI_Hs01_00114229 predicted 2645
8 SASI_Hs01_00114230 predicted 878
9 SASI_Hs02_00358974 predicted 1816
10 SASI_Hs01_00114231 predicted 2737
11 SASI_Hs01_00114225 predicted 1013
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024765 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202644 predicted 1635
2 SASI_Rn01_00053974 predicted 2114
3 SASI_Rn01_00053975 predicted 1312
4 SASI_Rn02_00202645 predicted 748
5 SASI_Rn01_00053977 predicted 368
6 SASI_Rn01_00053978 predicted 2263
7 SASI_Rn01_00053980 predicted 495
8 SASI_Rn02_00202646 predicted 1858
9 SASI_Rn01_00053982 predicted 1377
10 SASI_Rn01_00053983 predicted 1943
11 SASI_Rn01_00053976 predicted 1602
12 SASI_Rn01_00053979 predicted 2388
13 SASI_Rn01_00053981 predicted 2134
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008676 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138660 predicted 735
2 SASI_Mm01_00138661 predicted 1083
3 SASI_Mm01_00138662 predicted 1491
4 SASI_Mm01_00138663 predicted 485
5 SASI_Mm01_00138664 predicted 2222
6 SASI_Mm01_00138665 predicted 3249
7 SASI_Mm01_00138666 predicted 1688
8 SASI_Mm01_00138668 predicted 612
9 SASI_Mm01_00138669 predicted 3310
10 SASI_Mm02_00314448 predicted 627
11 SASI_Mm01_00138667 predicted 2375
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008676
VALIDATED
NBR1 MISSION shRNA Bacterial Glycerol Stock
neighbor of BRCA1 gene 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008676.1-1000s1c1
Sequence:CCGGCCTACAACATTTGTGAAGATTCTCGAGAATCTTCACAAATGTTGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008676.1-501s1c1
Sequence:CCGGGCTAACATTAAGCAAGGAAATCTCGAGATTTCCTTGCTTAATGTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008676.1-3121s1c1
Sequence:CCGGCCCATCTCTTTGAAATGGGATCTCGAGATCCCATTTCAAAGAGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123384    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008676.1-3648s1c1
Sequence:CCGGCCTTGAATGTTTCCAAGAATTCTCGAGAATTCTTGGAAACATTCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008676.1-1233s1c1
Sequence:CCGGGCAGAGGTCAAAGAGCTTAAACTCGAGTTTAAGCTCTTTGACCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008676.2-2217s21c1
Sequence:CCGGGACCTGAGTGGGACCCAATTTCTCGAGAAATTGGGTCCCACTCAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008676.2-872s21c1
Sequence:CCGGAGAAGTCTCAATGCCTATTTCCTCGAGGAAATAGGCATTGAGACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008676.2-1978s21c1
Sequence:CCGGCCTTTGAGCTGCTGGATATAACTCGAGTTATATCCAGCAGCTCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008676.2-3235s21c1
Sequence:CCGGACTGGTACAGCCACCGCTATTCTCGAGAATAGCGGTGGCTGTACCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008676
VALIDATED
NBR1 MISSION shRNA shRNA Plasmid DNA
neighbor of BRCA1 gene 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008676.1-1000s1c1
Sequence:CCGGCCTACAACATTTGTGAAGATTCTCGAGAATCTTCACAAATGTTGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008676.1-501s1c1
Sequence:CCGGGCTAACATTAAGCAAGGAAATCTCGAGATTTCCTTGCTTAATGTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008676.1-3121s1c1
Sequence:CCGGCCCATCTCTTTGAAATGGGATCTCGAGATCCCATTTCAAAGAGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123384    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008676.1-3648s1c1
Sequence:CCGGCCTTGAATGTTTCCAAGAATTCTCGAGAATTCTTGGAAACATTCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008676.1-1233s1c1
Sequence:CCGGGCAGAGGTCAAAGAGCTTAAACTCGAGTTTAAGCTCTTTGACCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008676.2-2217s21c1
Sequence:CCGGGACCTGAGTGGGACCCAATTTCTCGAGAAATTGGGTCCCACTCAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008676.2-872s21c1
Sequence:CCGGAGAAGTCTCAATGCCTATTTCCTCGAGGAAATAGGCATTGAGACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008676.2-1978s21c1
Sequence:CCGGCCTTTGAGCTGCTGGATATAACTCGAGTTATATCCAGCAGCTCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008676.2-3235s21c1
Sequence:CCGGACTGGTACAGCCACCGCTATTCTCGAGAATAGCGGTGGCTGTACCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008676
VALIDATED
NBR1 MISSION shRNA Lentiviral Transduction Particles
neighbor of BRCA1 gene 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008676.1-1000s1c1
Sequence:CCGGCCTACAACATTTGTGAAGATTCTCGAGAATCTTCACAAATGTTGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008676.1-501s1c1
Sequence:CCGGGCTAACATTAAGCAAGGAAATCTCGAGATTTCCTTGCTTAATGTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008676.1-3121s1c1
Sequence:CCGGCCCATCTCTTTGAAATGGGATCTCGAGATCCCATTTCAAAGAGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123384    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008676.1-3648s1c1
Sequence:CCGGCCTTGAATGTTTCCAAGAATTCTCGAGAATTCTTGGAAACATTCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008676.1-1233s1c1
Sequence:CCGGGCAGAGGTCAAAGAGCTTAAACTCGAGTTTAAGCTCTTTGACCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008676.2-2217s21c1
Sequence:CCGGGACCTGAGTGGGACCCAATTTCTCGAGAAATTGGGTCCCACTCAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008676.2-872s21c1
Sequence:CCGGAGAAGTCTCAATGCCTATTTCCTCGAGGAAATAGGCATTGAGACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008676.2-1978s21c1
Sequence:CCGGCCTTTGAGCTGCTGGATATAACTCGAGTTATATCCAGCAGCTCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008676.2-3235s21c1
Sequence:CCGGACTGGTACAGCCACCGCTATTCTCGAGAATAGCGGTGGCTGTACCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031858
VALIDATED
NBR1 MISSION shRNA Bacterial Glycerol Stock
neighbor of BRCA1 gene 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031858.1-670s1c1
Sequence:CCGGGCAGTTAAACAGGGAAACCAACTCGAGTTGGTTTCCCTGTTTAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031858.1-1162s1c1
Sequence:CCGGCCATCCTACAATATCTGTGAACTCGAGTTCACAGATATTGTAGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031858.1-1620s1c1
Sequence:CCGGGCCAGGAACCAAGTTTATCAACTCGAGTTGATAAACTTGGTTCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031858.1-1576s1c1
Sequence:CCGGGCAGCATTTGTGGATGAGAATCTCGAGATTCTCATCCACAAATGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031858.1-3820s1c1
Sequence:CCGGGCTTCATAGTTATTTGGCATTCTCGAGAATGCCAAATAACTATGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031858.2-645s21c1
Sequence:CCGGAGAATATGAAGAAGCGCTTAACTCGAGTTAAGCGCTTCTTCATATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031858.2-1323s21c1
Sequence:CCGGGCTCCAGAAACAGGTTGATAACTCGAGTTATCAACCTGTTTCTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031858.2-3429s21c1
Sequence:CCGGGATAGAAGCCCTTGCTTATTTCTCGAGAAATAAGCAAGGGCTTCTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031858.2-3338s21c1
Sequence:CCGGACTGGTACAGCCAACGCTATTCTCGAGAATAGCGTTGGCTGTACCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365456    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031858.2-3814s21c1
Sequence:CCGGCCTCAAGCTTCATAGTTATTTCTCGAGAAATAACTATGAAGCTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031858.2-546s21c1
Sequence:CCGGTGATATCGAAGCTATGGTAAACTCGAGTTTACCATAGCTTCGATATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031858.2-2144s21c1
Sequence:CCGGCCTTTGAGCTGTTGGATATAACTCGAGTTATATCCAACAGCTCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031858.2-1154s21c1
Sequence:CCGGGCCTATGCCCATCCTACAATACTCGAGTATTGTAGGATGGGCATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031858
VALIDATED
NBR1 MISSION shRNA shRNA Plasmid DNA
neighbor of BRCA1 gene 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031858.1-670s1c1
Sequence:CCGGGCAGTTAAACAGGGAAACCAACTCGAGTTGGTTTCCCTGTTTAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031858.1-1162s1c1
Sequence:CCGGCCATCCTACAATATCTGTGAACTCGAGTTCACAGATATTGTAGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031858.1-1620s1c1
Sequence:CCGGGCCAGGAACCAAGTTTATCAACTCGAGTTGATAAACTTGGTTCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031858.1-1576s1c1
Sequence:CCGGGCAGCATTTGTGGATGAGAATCTCGAGATTCTCATCCACAAATGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031858.1-3820s1c1
Sequence:CCGGGCTTCATAGTTATTTGGCATTCTCGAGAATGCCAAATAACTATGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031858.2-645s21c1
Sequence:CCGGAGAATATGAAGAAGCGCTTAACTCGAGTTAAGCGCTTCTTCATATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031858.2-1323s21c1
Sequence:CCGGGCTCCAGAAACAGGTTGATAACTCGAGTTATCAACCTGTTTCTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031858.2-3429s21c1
Sequence:CCGGGATAGAAGCCCTTGCTTATTTCTCGAGAAATAAGCAAGGGCTTCTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031858.2-3338s21c1
Sequence:CCGGACTGGTACAGCCAACGCTATTCTCGAGAATAGCGTTGGCTGTACCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365456    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031858.2-3814s21c1
Sequence:CCGGCCTCAAGCTTCATAGTTATTTCTCGAGAAATAACTATGAAGCTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031858.2-546s21c1
Sequence:CCGGTGATATCGAAGCTATGGTAAACTCGAGTTTACCATAGCTTCGATATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031858.2-2144s21c1
Sequence:CCGGCCTTTGAGCTGTTGGATATAACTCGAGTTATATCCAACAGCTCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031858.2-1154s21c1
Sequence:CCGGGCCTATGCCCATCCTACAATACTCGAGTATTGTAGGATGGGCATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031858
VALIDATED
NBR1 MISSION shRNA Lentiviral Transduction Particles
neighbor of BRCA1 gene 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031858.1-670s1c1
Sequence:CCGGGCAGTTAAACAGGGAAACCAACTCGAGTTGGTTTCCCTGTTTAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031858.1-1162s1c1
Sequence:CCGGCCATCCTACAATATCTGTGAACTCGAGTTCACAGATATTGTAGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031858.1-1620s1c1
Sequence:CCGGGCCAGGAACCAAGTTTATCAACTCGAGTTGATAAACTTGGTTCCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031858.1-1576s1c1
Sequence:CCGGGCAGCATTTGTGGATGAGAATCTCGAGATTCTCATCCACAAATGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031858.1-3820s1c1
Sequence:CCGGGCTTCATAGTTATTTGGCATTCTCGAGAATGCCAAATAACTATGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031858.2-645s21c1
Sequence:CCGGAGAATATGAAGAAGCGCTTAACTCGAGTTAAGCGCTTCTTCATATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031858.2-1323s21c1
Sequence:CCGGGCTCCAGAAACAGGTTGATAACTCGAGTTATCAACCTGTTTCTGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031858.2-3429s21c1
Sequence:CCGGGATAGAAGCCCTTGCTTATTTCTCGAGAAATAAGCAAGGGCTTCTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031858.2-3338s21c1
Sequence:CCGGACTGGTACAGCCAACGCTATTCTCGAGAATAGCGTTGGCTGTACCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365456    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031858.2-3814s21c1
Sequence:CCGGCCTCAAGCTTCATAGTTATTTCTCGAGAAATAACTATGAAGCTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031858.2-546s21c1
Sequence:CCGGTGATATCGAAGCTATGGTAAACTCGAGTTTACCATAGCTTCGATATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031858.2-2144s21c1
Sequence:CCGGCCTTTGAGCTGTTGGATATAACTCGAGTTATATCCAACAGCTCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031858.2-1154s21c1
Sequence:CCGGGCCTATGCCCATCCTACAATACTCGAGTATTGTAGGATGGGCATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)