EMAIL THIS PAGE TO A FRIEND

NBR2

neighbor of BRCA1 gene 2 (non-protein coding)

182 Gene Product Result for
Synonyms: NCRNA00192
Species: Human NBR2(10230)
UniProtKB ID: O15453, Q3LRJ7
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
GW21248 Anti-NBR2 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005821 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005821 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005821 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005821 Rosetta Predictions human pricing
NR_003108 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005821 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028663 predicted 1143
2 SASI_Hs01_00028664 predicted 1201
3 SASI_Hs01_00028665 predicted 1268
4 SASI_Hs01_00028666 predicted 1269
5 SASI_Hs01_00028667 predicted 1279
6 SASI_Hs01_00028668 predicted 1277
7 SASI_Hs01_00028669 predicted 1180
8 SASI_Hs01_00028670 predicted 1278
9 SASI_Hs01_00028671 predicted 1270
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003108 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00378266 predicted 196
2 SASI_Hs02_00378267 predicted 199
3 SASI_Hs02_00378268 predicted 58
4 SASI_Hs02_00378269 predicted 66
5 SASI_Hs02_00378270 predicted 61
6 SASI_Hs02_00378271 predicted 74
7 SASI_Hs02_00378272 predicted 62
8 SASI_Hs02_00378273 predicted 90
9 SASI_Hs02_00378274 predicted 97
10 SASI_Hs02_00378275 predicted 1269
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005821
NBR2 MISSION shRNA Bacterial Glycerol Stock
neighbor of BRCA1 gene 2 (non-protein coding)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005821.2-472s1c1
Sequence:CCGGCCTCTGGAAATCAGCTGTGTTCTCGAGAACACAGCTGATTTCCAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005821.2-478s1c1
Sequence:CCGGGAAATCAGCTGTGTTTGCTGACTCGAGTCAGCAAACACAGCTGATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005821.2-575s1c1
Sequence:CCGGGTTCTAACGTTTGGTCCTTCACTCGAGTGAAGGACCAAACGTTAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005821.2-615s1c1
Sequence:CCGGGATTCCTAAATCCCTTGGAATCTCGAGATTCCAAGGGATTTAGGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161036    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005821.2-514s1c1
Sequence:CCGGGATCCATCTGTGTTCCTACAACTCGAGTTGTAGGAACACAGATGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005821.2-485s1c1
Sequence:CCGGGCTGTGTTTGCTGAGGATAATCTCGAGATTATCCTCAGCAAACACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005821.2-507s1c1
Sequence:CCGGGCCTCAAGATCCATCTGTGTTCTCGAGAACACAGATGGATCTTGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005821.2-604s1c1
Sequence:CCGGCCTGACACAAGGATTCCTAAACTCGAGTTTAGGAATCCTTGTGTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005821.2-495s1c1
Sequence:CCGGCTGAGGATAATGGCCTCAAGACTCGAGTCTTGAGGCCATTATCCTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005821
NBR2 MISSION shRNA shRNA Plasmid DNA
neighbor of BRCA1 gene 2 (non-protein coding)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005821.2-472s1c1
Sequence:CCGGCCTCTGGAAATCAGCTGTGTTCTCGAGAACACAGCTGATTTCCAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005821.2-478s1c1
Sequence:CCGGGAAATCAGCTGTGTTTGCTGACTCGAGTCAGCAAACACAGCTGATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005821.2-575s1c1
Sequence:CCGGGTTCTAACGTTTGGTCCTTCACTCGAGTGAAGGACCAAACGTTAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005821.2-615s1c1
Sequence:CCGGGATTCCTAAATCCCTTGGAATCTCGAGATTCCAAGGGATTTAGGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161036    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005821.2-514s1c1
Sequence:CCGGGATCCATCTGTGTTCCTACAACTCGAGTTGTAGGAACACAGATGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005821.2-485s1c1
Sequence:CCGGGCTGTGTTTGCTGAGGATAATCTCGAGATTATCCTCAGCAAACACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005821.2-507s1c1
Sequence:CCGGGCCTCAAGATCCATCTGTGTTCTCGAGAACACAGATGGATCTTGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005821.2-604s1c1
Sequence:CCGGCCTGACACAAGGATTCCTAAACTCGAGTTTAGGAATCCTTGTGTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005821.2-495s1c1
Sequence:CCGGCTGAGGATAATGGCCTCAAGACTCGAGTCTTGAGGCCATTATCCTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005821
NBR2 MISSION shRNA Lentiviral Transduction Particles
neighbor of BRCA1 gene 2 (non-protein coding)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005821.2-472s1c1
Sequence:CCGGCCTCTGGAAATCAGCTGTGTTCTCGAGAACACAGCTGATTTCCAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005821.2-478s1c1
Sequence:CCGGGAAATCAGCTGTGTTTGCTGACTCGAGTCAGCAAACACAGCTGATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005821.2-575s1c1
Sequence:CCGGGTTCTAACGTTTGGTCCTTCACTCGAGTGAAGGACCAAACGTTAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005821.2-615s1c1
Sequence:CCGGGATTCCTAAATCCCTTGGAATCTCGAGATTCCAAGGGATTTAGGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161036    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005821.2-514s1c1
Sequence:CCGGGATCCATCTGTGTTCCTACAACTCGAGTTGTAGGAACACAGATGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005821.2-485s1c1
Sequence:CCGGGCTGTGTTTGCTGAGGATAATCTCGAGATTATCCTCAGCAAACACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005821.2-507s1c1
Sequence:CCGGGCCTCAAGATCCATCTGTGTTCTCGAGAACACAGATGGATCTTGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005821.2-604s1c1
Sequence:CCGGCCTGACACAAGGATTCCTAAACTCGAGTTTAGGAATCCTTGTGTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005821.2-495s1c1
Sequence:CCGGCTGAGGATAATGGCCTCAAGACTCGAGTCTTGAGGCCATTATCCTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)