EMAIL THIS PAGE TO A FRIEND

NCALD

neurocalcin delta

209 Gene Product Result for
UniProtKB ID: P61601, P29554, Q8IYC3, Q9H0W2
Gene ID:
Human(83988) Summary: This gene encodes a member of the neuronal calcium sensor (NCS) family of calcium-binding proteins. The protein contains an N-terminal myristoylation signal and four EF-hand calcium binding loops. The protein is cytosolic at resting calcium levels; however, elevated intracellular calcium levels induce a conformational change that exposes the myristoyl group, resulting in protein association with membranes and partial co-localization with the perinuclear trans-golgi network. The protein is thought to be a regulator of G protein-coupled receptor signal transduction. Several alternatively spliced variants of this gene have been determined, all of which encode the same protein; additional variants may exist but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Mouse(52589) neurocalcin delta
Rat(553106) neurocalcin delta
chicken(396048) neurocalcin delta
cow(281940) neurocalcin delta
domestic cat(101099527) neurocalcin delta
dog(475053) neurocalcin delta
sheep(101102069) neurocalcin delta
naked mole-rat(101717653) neurocalcin delta
domestic guinea pig(100717439) neurocalcin delta
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_134094 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134094 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134094 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032041 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032041 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032041 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU145551 MISSION® esiRNA esiRNA human NCALD (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040624 Rosetta Predictions human pricing
NM_001040625 Rosetta Predictions human pricing
NM_001040626 Rosetta Predictions human pricing
NM_001040627 Rosetta Predictions human pricing
NM_001040628 Rosetta Predictions human pricing
NM_001040629 Rosetta Predictions human pricing
NM_001040630 Rosetta Predictions human pricing
NM_032041 Rosetta Predictions human pricing
NM_001024371 Rosetta Predictions rat pricing
NM_134094 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040624 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171403 predicted 728
2 SASI_Hs01_00171404 predicted 625
3 SASI_Hs01_00171405 predicted 856
4 SASI_Hs01_00171406 predicted 427
5 SASI_Hs01_00171407 predicted 603
6 SASI_Hs02_00309014 predicted 1159
7 SASI_Hs01_00171408 predicted 721
8 SASI_Hs01_00171410 predicted 443
9 SASI_Hs01_00171411 predicted 617
10 SASI_Hs01_00171412 predicted 1314
11 SASI_Hs01_00171409 predicted 441
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040625 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098306 predicted 646
2 SASI_Hs01_00098307 predicted 531
3 SASI_Hs01_00098308 predicted 772
4 SASI_Hs01_00098309 predicted 343
5 SASI_Hs01_00098310 predicted 514
6 SASI_Hs02_00309015 predicted 1076
7 SASI_Hs01_00098311 predicted 633
8 SASI_Hs01_00098313 predicted 356
9 SASI_Hs01_00098314 predicted 530
10 SASI_Hs01_00098315 predicted 1224
11 SASI_Hs01_00098312 predicted 355
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040626 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235626 predicted 640
2 SASI_Hs01_00235627 predicted 538
3 SASI_Hs01_00235628 predicted 771
4 SASI_Hs01_00235629 predicted 339
5 SASI_Hs01_00235630 predicted 507
6 SASI_Hs02_00309016 predicted 1079
7 SASI_Hs01_00235631 predicted 634
8 SASI_Hs01_00235633 predicted 358
9 SASI_Hs01_00235634 predicted 531
10 SASI_Hs01_00235635 predicted 1233
11 SASI_Hs01_00235632 predicted 353
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040627 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013950 predicted 555
2 SASI_Hs01_00013951 predicted 450
3 SASI_Hs01_00013952 predicted 682
4 SASI_Hs01_00013953 predicted 259
5 SASI_Hs01_00013954 predicted 420
6 SASI_Hs02_00309017 predicted 993
7 SASI_Hs01_00013955 predicted 542
8 SASI_Hs01_00013957 predicted 272
9 SASI_Hs01_00013958 predicted 445
10 SASI_Hs01_00013959 predicted 1144
11 SASI_Hs01_00013956 predicted 270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040628 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090609 predicted 699
2 SASI_Hs01_00090610 predicted 591
3 SASI_Hs01_00090611 predicted 828
4 SASI_Hs01_00090612 predicted 395
5 SASI_Hs01_00090613 predicted 570
6 SASI_Hs02_00309018 predicted 1134
7 SASI_Hs01_00090614 predicted 692
8 SASI_Hs01_00090616 predicted 411
9 SASI_Hs01_00090617 predicted 582
10 SASI_Hs01_00090618 predicted 1289
11 SASI_Hs01_00090615 predicted 417
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040629 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054942 predicted 608
2 SASI_Hs01_00054943 predicted 504
3 SASI_Hs01_00054944 predicted 739
4 SASI_Hs01_00054945 predicted 310
5 SASI_Hs01_00054946 predicted 478
6 SASI_Hs02_00309019 predicted 1042
7 SASI_Hs01_00054947 predicted 601
8 SASI_Hs01_00054949 predicted 325
9 SASI_Hs01_00054950 predicted 501
10 SASI_Hs01_00054951 predicted 1200
11 SASI_Hs01_00054948 predicted 330
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040630 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198896 predicted 796
2 SASI_Hs01_00198897 predicted 683
3 SASI_Hs01_00198898 predicted 919
4 SASI_Hs01_00198899 predicted 493
5 SASI_Hs01_00198900 predicted 660
6 SASI_Hs02_00309020 predicted 1233
7 SASI_Hs01_00198901 predicted 785
8 SASI_Hs01_00198903 predicted 508
9 SASI_Hs01_00198904 predicted 682
10 SASI_Hs01_00198905 predicted 1380
11 SASI_Hs01_00198902 predicted 507
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032041 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241116 predicted 705
2 SASI_Hs01_00241117 predicted 598
3 SASI_Hs01_00241118 predicted 832
4 SASI_Hs01_00241119 predicted 408
5 SASI_Hs01_00241120 predicted 578
6 SASI_Hs02_00359239 predicted 1143
7 SASI_Hs01_00241121 predicted 696
8 SASI_Hs01_00241123 predicted 422
9 SASI_Hs01_00241124 predicted 592
10 SASI_Hs01_00241125 predicted 1288
11 SASI_Hs01_00241122 predicted 422
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024371 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116675 predicted 372
2 SASI_Rn02_00202602 predicted 201
3 SASI_Rn01_00116676 predicted 394
4 SASI_Rn02_00202603 predicted 402
5 SASI_Rn01_00116677 predicted 228
6 SASI_Rn01_00116678 predicted 383
7 SASI_Rn01_00116681 predicted 401
8 SASI_Rn01_00116682 predicted 403
9 SASI_Rn01_00116683 predicted 388
10 SASI_Rn01_00116684 predicted 1061
11 SASI_Rn01_00116679 predicted 509
12 SASI_Rn01_00116680 predicted 291
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134094 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148606 predicted 690
2 SASI_Mm02_00339321 predicted 720
3 SASI_Mm02_00339322 predicted 711
4 SASI_Mm01_00148607 predicted 932
5 SASI_Mm01_00148608 predicted 919
6 SASI_Mm02_00339323 predicted 713
7 SASI_Mm01_00148609 predicted 677
8 SASI_Mm01_00148610 predicted 493
9 SASI_Mm01_00148611 predicted 538
10 SASI_Mm02_00339324 predicted 699
11 SASI_Mm01_00148605 predicted 591
12 SASI_Mm01_00148612 predicted 998
13 SASI_Mm01_00148613 predicted 593
14 SASI_Mm01_00148614 predicted 504
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134094
VALIDATED
NCALD MISSION shRNA Bacterial Glycerol Stock
neurocalcin delta
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000327293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134094.3-653s21c1
Sequence:CCGGGCTTCCAAATTTGCAGAGCATCTCGAGATGCTCTGCAAATTTGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134094.3-2329s21c1
Sequence:CCGGGCCAGGTGATTCACCCATTATCTCGAGATAATGGGTGAATCACCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134094.3-692s21c1
Sequence:CCGGGCAAACGGTGATGGGACAATACTCGAGTATTGTCCCATCACCGTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134094.3-932s21c1
Sequence:CCGGCGCCAGATGGATACCAATAGACTCGAGTCTATTGGTATCCATCTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134094.2-933s1c1
Sequence:CCGGCGCCAGATGGATACCAATAGACTCGAGTCTATTGGTATCCATCTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104695    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134094.2-2330s1c1
Sequence:CCGGGCCAGGTGATTCACCCATTATCTCGAGATAATGGGTGAATCACCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134094.2-693s1c1
Sequence:CCGGGCAAACGGTGATGGGACAATACTCGAGTATTGTCCCATCACCGTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134094.2-654s1c1
Sequence:CCGGGCTTCCAAATTTGCAGAGCATCTCGAGATGCTCTGCAAATTTGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134094.2-501s1c1
Sequence:CCGGCCTGAAGTCATGCAGGACTTACTCGAGTAAGTCCTGCATGACTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134094.3-500s21c1
Sequence:CCGGCCTGAAGTCATGCAGGACTTACTCGAGTAAGTCCTGCATGACTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134094
VALIDATED
NCALD MISSION shRNA shRNA Plasmid DNA
neurocalcin delta
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000327293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134094.3-653s21c1
Sequence:CCGGGCTTCCAAATTTGCAGAGCATCTCGAGATGCTCTGCAAATTTGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134094.3-2329s21c1
Sequence:CCGGGCCAGGTGATTCACCCATTATCTCGAGATAATGGGTGAATCACCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134094.3-692s21c1
Sequence:CCGGGCAAACGGTGATGGGACAATACTCGAGTATTGTCCCATCACCGTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134094.3-932s21c1
Sequence:CCGGCGCCAGATGGATACCAATAGACTCGAGTCTATTGGTATCCATCTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134094.2-933s1c1
Sequence:CCGGCGCCAGATGGATACCAATAGACTCGAGTCTATTGGTATCCATCTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104695    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134094.2-2330s1c1
Sequence:CCGGGCCAGGTGATTCACCCATTATCTCGAGATAATGGGTGAATCACCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134094.2-693s1c1
Sequence:CCGGGCAAACGGTGATGGGACAATACTCGAGTATTGTCCCATCACCGTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134094.2-654s1c1
Sequence:CCGGGCTTCCAAATTTGCAGAGCATCTCGAGATGCTCTGCAAATTTGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134094.2-501s1c1
Sequence:CCGGCCTGAAGTCATGCAGGACTTACTCGAGTAAGTCCTGCATGACTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134094.3-500s21c1
Sequence:CCGGCCTGAAGTCATGCAGGACTTACTCGAGTAAGTCCTGCATGACTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134094
VALIDATED
NCALD MISSION shRNA Lentiviral Transduction Particles
neurocalcin delta
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000327293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134094.3-653s21c1
Sequence:CCGGGCTTCCAAATTTGCAGAGCATCTCGAGATGCTCTGCAAATTTGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134094.3-2329s21c1
Sequence:CCGGGCCAGGTGATTCACCCATTATCTCGAGATAATGGGTGAATCACCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134094.3-692s21c1
Sequence:CCGGGCAAACGGTGATGGGACAATACTCGAGTATTGTCCCATCACCGTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134094.3-932s21c1
Sequence:CCGGCGCCAGATGGATACCAATAGACTCGAGTCTATTGGTATCCATCTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134094.2-933s1c1
Sequence:CCGGCGCCAGATGGATACCAATAGACTCGAGTCTATTGGTATCCATCTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104695    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134094.2-2330s1c1
Sequence:CCGGGCCAGGTGATTCACCCATTATCTCGAGATAATGGGTGAATCACCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134094.2-693s1c1
Sequence:CCGGGCAAACGGTGATGGGACAATACTCGAGTATTGTCCCATCACCGTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134094.2-654s1c1
Sequence:CCGGGCTTCCAAATTTGCAGAGCATCTCGAGATGCTCTGCAAATTTGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134094.2-501s1c1
Sequence:CCGGCCTGAAGTCATGCAGGACTTACTCGAGTAAGTCCTGCATGACTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134094.3-500s21c1
Sequence:CCGGCCTGAAGTCATGCAGGACTTACTCGAGTAAGTCCTGCATGACTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032041
NCALD MISSION shRNA Bacterial Glycerol Stock
neurocalcin delta
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000153990    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032041.1-2372s1c1
Sequence:CCGGCCACAGAAAGAGAGACATCATCTCGAGATGATGTCTCTCTTTCTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032041.1-193s1c1
Sequence:CCGGCATGAGATCCAGGAATGGTATCTCGAGATACCATTCCTGGATCTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152815    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032041.1-2268s1c1
Sequence:CCGGGCCCAAATTCTCAAGGTTGTTCTCGAGAACAACCTTGAGAATTTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151437    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032041.1-1498s1c1
Sequence:CCGGGCATGTTTAGTGAGCACTAATCTCGAGATTAGTGCTCACTAAACATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032041.1-306s1c1
Sequence:CCGGCAAATTTGCAGAGCATGTCTTCTCGAGAAGACATGCTCTGCAAATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032041.1-347s1c1
Sequence:CCGGGAGATGGGACAATAGACTTTACTCGAGTAAAGTCTATTGTCCCATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152345    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032041.1-1991s1c1
Sequence:CCGGCCTGTTAAAGAATCAGAGGTTCTCGAGAACCTCTGATTCTTTAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032041.1-340s1c1
Sequence:CCGGGCAAATGGAGATGGGACAATACTCGAGTATTGTCCCATCTCCATTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032041.1-201s1c1
Sequence:CCGGCCAGGAATGGTATAAAGGCTTCTCGAGAAGCCTTTATACCATTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032041.1-447s1c1
Sequence:CCGGCCTGGACGGAAATGGCTATATCTCGAGATATAGCCATTTCCGTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032041.1-487s1c1
Sequence:CCGGGTGATCGTGCAGGCAATCTATCTCGAGATAGATTGCCTGCACGATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032041.1-495s1c1
Sequence:CCGGGCAGGCAATCTATAAGATGGTCTCGAGACCATCTTATAGATTGCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032041
NCALD MISSION shRNA shRNA Plasmid DNA
neurocalcin delta
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000153990    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032041.1-2372s1c1
Sequence:CCGGCCACAGAAAGAGAGACATCATCTCGAGATGATGTCTCTCTTTCTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032041.1-193s1c1
Sequence:CCGGCATGAGATCCAGGAATGGTATCTCGAGATACCATTCCTGGATCTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152815    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032041.1-2268s1c1
Sequence:CCGGGCCCAAATTCTCAAGGTTGTTCTCGAGAACAACCTTGAGAATTTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151437    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032041.1-1498s1c1
Sequence:CCGGGCATGTTTAGTGAGCACTAATCTCGAGATTAGTGCTCACTAAACATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032041.1-306s1c1
Sequence:CCGGCAAATTTGCAGAGCATGTCTTCTCGAGAAGACATGCTCTGCAAATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032041.1-347s1c1
Sequence:CCGGGAGATGGGACAATAGACTTTACTCGAGTAAAGTCTATTGTCCCATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152345    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032041.1-1991s1c1
Sequence:CCGGCCTGTTAAAGAATCAGAGGTTCTCGAGAACCTCTGATTCTTTAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032041.1-340s1c1
Sequence:CCGGGCAAATGGAGATGGGACAATACTCGAGTATTGTCCCATCTCCATTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032041.1-201s1c1
Sequence:CCGGCCAGGAATGGTATAAAGGCTTCTCGAGAAGCCTTTATACCATTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032041.1-447s1c1
Sequence:CCGGCCTGGACGGAAATGGCTATATCTCGAGATATAGCCATTTCCGTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032041.1-487s1c1
Sequence:CCGGGTGATCGTGCAGGCAATCTATCTCGAGATAGATTGCCTGCACGATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032041.1-495s1c1
Sequence:CCGGGCAGGCAATCTATAAGATGGTCTCGAGACCATCTTATAGATTGCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032041
NCALD MISSION shRNA Lentiviral Transduction Particles
neurocalcin delta
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000153990    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032041.1-2372s1c1
Sequence:CCGGCCACAGAAAGAGAGACATCATCTCGAGATGATGTCTCTCTTTCTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032041.1-193s1c1
Sequence:CCGGCATGAGATCCAGGAATGGTATCTCGAGATACCATTCCTGGATCTCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152815    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032041.1-2268s1c1
Sequence:CCGGGCCCAAATTCTCAAGGTTGTTCTCGAGAACAACCTTGAGAATTTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151437    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032041.1-1498s1c1
Sequence:CCGGGCATGTTTAGTGAGCACTAATCTCGAGATTAGTGCTCACTAAACATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032041.1-306s1c1
Sequence:CCGGCAAATTTGCAGAGCATGTCTTCTCGAGAAGACATGCTCTGCAAATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032041.1-347s1c1
Sequence:CCGGGAGATGGGACAATAGACTTTACTCGAGTAAAGTCTATTGTCCCATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152345    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032041.1-1991s1c1
Sequence:CCGGCCTGTTAAAGAATCAGAGGTTCTCGAGAACCTCTGATTCTTTAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032041.1-340s1c1
Sequence:CCGGGCAAATGGAGATGGGACAATACTCGAGTATTGTCCCATCTCCATTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032041.1-201s1c1
Sequence:CCGGCCAGGAATGGTATAAAGGCTTCTCGAGAAGCCTTTATACCATTCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032041.1-447s1c1
Sequence:CCGGCCTGGACGGAAATGGCTATATCTCGAGATATAGCCATTTCCGTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032041.1-487s1c1
Sequence:CCGGGTGATCGTGCAGGCAATCTATCTCGAGATAGATTGCCTGCACGATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032041.1-495s1c1
Sequence:CCGGGCAGGCAATCTATAAGATGGTCTCGAGACCATCTTATAGATTGCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)