EMAIL THIS PAGE TO A FRIEND

NCAM1

neural cell adhesion molecule 1

328 Gene Product Result for
Synonyms: CD56 MSK39 NCAM
Gene ID:
Human(4684) Summary: This gene encodes a cell adhesion protein which is a member of the immunoglobulin superfamily. The encoded protein is involved in cell-to-cell interactions as well as cell-matrix interactions during development and differentiation. The encoded protein has been shown to be involved in development of the nervous system, and for cells involved in the expansion of T cells and dendritic cells which play an important role in immune surveillance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2011]
Mouse(17967) neural cell adhesion molecule 1
Rat(24586) neural cell adhesion molecule 1
chicken(428253) neural cell adhesion molecule 1
Horse(100062164) neural cell adhesion molecule 1
cow(281941) neural cell adhesion molecule 1
domestic cat(493956) neural cell adhesion molecule 1
dog(479435) neural cell adhesion molecule 1
domestic guinea pig(100714496) neural cell adhesion molecule 1
naked mole-rat(101707044) neural cell adhesion molecule 1
Domestic Rabbit(100348118) neural cell adhesion molecule 1
sheep(101112759) neural cell adhesion molecule 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2700234 Anti-Ncam1 (N-terminal) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, mouse
western blot pricing
SAB2501672 Anti-NCAM1 antibody produced in goat affinity isolated antibody, buffered aqueous solution pig, rat, human, bovine
ELISA, western blot pricing
HPA039835 Anti-NCAM1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300660 Anti-NCAM1 antibody produced in rabbit affinity isolated antibody mouse, human, rat
western blot pricing
SAB4700449 Monoclonal Anti-CD56 antibody produced in mouse clone MEM-188, purified immunoglobulin, buffered aqueous solution nonhuman primates, human
flow cytometry pricing
SAB4700450 Monoclonal Anti-CD56-APC antibody produced in mouse clone MEM-188, purified immunoglobulin, buffered aqueous solution nonhuman primates, human
flow cytometry pricing
SAB4700451 Monoclonal Anti-CD56-Biotin antibody produced in mouse clone MEM-188, purified immunoglobulin, buffered aqueous solution human, nonhuman primates
flow cytometry pricing
SAB4700452 Monoclonal Anti-CD56-FITC antibody produced in mouse clone MEM-188, purified immunoglobulin, buffered aqueous solution nonhuman primates, human
flow cytometry pricing
F0301 Monoclonal Anti-CD56-FITC antibody produced in mouse clone C5.9, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700453 Monoclonal Anti-CD56-PE antibody produced in mouse clone MEM-188, purified immunoglobulin, buffered aqueous solution nonhuman primates, human
flow cytometry pricing
WH0004684M1 Monoclonal Anti-NCAM1 antibody produced in mouse clone 3G12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
C9672 Monoclonal Anti-Neural Cell Adhesion Molecule antibody produced in mouse clone NCAM-0B11, ascites fluid human, rat
immunocytochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000615 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000615 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000615 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010875 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010875 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010875 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU095161 MISSION® esiRNA esiRNA human NCAM1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000615 Rosetta Predictions human pricing
NM_001076682 Rosetta Predictions human pricing
NM_181351 Rosetta Predictions human pricing
NM_031521 Rosetta Predictions rat pricing
NM_001081445 Rosetta Predictions mouse pricing
NM_001113204 Rosetta Predictions mouse pricing
NM_010875 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000615 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098871 predicted 1613
2 SASI_Hs02_00302935 predicted 580
3 SASI_Hs02_00302936 predicted 649
4 SASI_Hs02_00302937 predicted 740
5 SASI_Hs02_00302938 predicted 1803
6 SASI_Hs02_00302939 predicted 1670
7 SASI_Hs02_00302940 predicted 1672
8 SASI_Hs01_00098873 predicted 538
9 SASI_Hs01_00098874 predicted 1620
10 SASI_Hs02_00302941 predicted 1741
11 SASI_Hs01_00098867 predicted 1556
12 SASI_Hs01_00098868 predicted 689
13 SASI_Hs01_00098869 predicted 2048
14 SASI_Hs01_00098870 predicted 2098
15 SASI_Hs01_00098872 predicted 1542
16 SASI_Hs01_00098875 predicted 2231
17 SASI_Hs01_00098876 predicted 1501
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001076682 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311984 predicted 1610
2 SASI_Hs02_00311985 predicted 576
3 SASI_Hs02_00311986 predicted 644
4 SASI_Hs02_00311987 predicted 734
5 SASI_Hs02_00311988 predicted 1797
6 SASI_Hs02_00311989 predicted 1668
7 SASI_Hs02_00311990 predicted 1673
8 SASI_Hs02_00311991 predicted 536
9 SASI_Hs02_00311992 predicted 1612
10 SASI_Hs02_00311993 predicted 1738
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181351 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150352 predicted 1648
2 SASI_Hs02_00370013 predicted 575
3 SASI_Hs02_00370014 predicted 652
4 SASI_Hs02_00370015 predicted 740
5 SASI_Hs02_00370016 predicted 1833
6 SASI_Hs02_00370017 predicted 1700
7 SASI_Hs02_00370018 predicted 1700
8 SASI_Hs01_00150354 predicted 536
9 SASI_Hs01_00150355 predicted 1648
10 SASI_Hs02_00370019 predicted 1763
11 SASI_Hs01_00150348 predicted 1556
12 SASI_Hs01_00150349 predicted 670
13 SASI_Hs01_00150350 predicted 2051
14 SASI_Hs01_00150351 predicted 2109
15 SASI_Hs01_00150353 predicted 1553
16 SASI_Hs01_00150356 predicted 2231
17 SASI_Hs01_00150357 predicted 1509
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031521 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089831 predicted 2472
2 SASI_Rn01_00089832 predicted 2133
3 SASI_Rn01_00089833 predicted 2242
4 SASI_Rn01_00089834 predicted 607
5 SASI_Rn01_00089836 predicted 1422
6 SASI_Rn01_00089837 predicted 2537
7 SASI_Rn02_00264651 predicted 2473
8 SASI_Rn01_00089838 predicted 2248
9 SASI_Rn01_00089839 predicted 1534
10 SASI_Rn02_00264652 predicted 1715
11 SASI_Rn01_00089835 predicted 1253
12 SASI_Rn01_00089840 predicted 291
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081445 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298391 predicted 1376
2 SASI_Mm02_00298392 predicted 1464
3 SASI_Mm02_00298393 predicted 780
4 SASI_Mm02_00298394 predicted 1279
5 SASI_Mm02_00298395 predicted 542
6 SASI_Mm02_00298396 predicted 1757
7 SASI_Mm02_00298397 predicted 1642
8 SASI_Mm02_00298398 predicted 1775
9 SASI_Mm02_00298399 predicted 424
10 SASI_Mm02_00298400 predicted 742
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113204 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307223 predicted 1372
2 SASI_Mm02_00307224 predicted 1468
3 SASI_Mm02_00307225 predicted 776
4 SASI_Mm02_00307226 predicted 1278
5 SASI_Mm02_00307227 predicted 534
6 SASI_Mm02_00307228 predicted 1757
7 SASI_Mm02_00307229 predicted 1637
8 SASI_Mm02_00307230 predicted 1775
9 SASI_Mm02_00307231 predicted 420
10 SASI_Mm02_00307232 predicted 742
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010875 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026500 predicted 1371
2 SASI_Mm02_00319549 predicted 1468
3 SASI_Mm02_00319550 predicted 774
4 SASI_Mm01_00026495 predicted 1277
5 SASI_Mm01_00026497 predicted 538
6 SASI_Mm01_00026498 predicted 1753
7 SASI_Mm01_00026499 predicted 1641
8 SASI_Mm01_00026501 predicted 1767
9 SASI_Mm01_00026503 predicted 422
10 SASI_Mm02_00319551 predicted 743
11 SASI_Mm01_00026496 predicted 2056
12 SASI_Mm01_00026502 predicted 1802
13 SASI_Mm01_00026504 predicted 1441
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000615
VALIDATED
NCAM1 MISSION shRNA Bacterial Glycerol Stock
neural cell adhesion molecule 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000615.5-433s21c1
Sequence:CCGGCAGCGTTGGAGAGTCCAAATTCTCGAGAATTTGGACTCTCCAACGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000615.5-2176s21c1
Sequence:CCGGAGAGGATGGAAACTCTATTAACTCGAGTTAATAGAGTTTCCATCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373034    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000615.5-3168s21c1
Sequence:CCGGCCGTTCCCTGAAACCGTTAAACTCGAGTTTAACGGTTTCAGGGAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073458    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000615.1-2796s1c1
Sequence:CCGGGCTTCACCAGAGCATTTCCAACTCGAGTTGGAAATGCTCTGGTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000615.1-1391s1c1
Sequence:CCGGCCATGTACCTTGAAGTGCAATCTCGAGATTGCACTTCAAGGTACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000615.1-1537s1c1
Sequence:CCGGCCAAGCTCCAATTACAGCAATCTCGAGATTGCTGTAATTGGAGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000615.1-1536s1c1
Sequence:CCGGGCCAAGCTCCAATTACAGCAACTCGAGTTGCTGTAATTGGAGCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000615.1-693s1c1
Sequence:CCGGCCGATTCATAGTCCTGTCCAACTCGAGTTGGACAGGACTATGAATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000615
VALIDATED
NCAM1 MISSION shRNA shRNA Plasmid DNA
neural cell adhesion molecule 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000615.5-433s21c1
Sequence:CCGGCAGCGTTGGAGAGTCCAAATTCTCGAGAATTTGGACTCTCCAACGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000615.5-2176s21c1
Sequence:CCGGAGAGGATGGAAACTCTATTAACTCGAGTTAATAGAGTTTCCATCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373034    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000615.5-3168s21c1
Sequence:CCGGCCGTTCCCTGAAACCGTTAAACTCGAGTTTAACGGTTTCAGGGAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073458    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000615.1-2796s1c1
Sequence:CCGGGCTTCACCAGAGCATTTCCAACTCGAGTTGGAAATGCTCTGGTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000615.1-1391s1c1
Sequence:CCGGCCATGTACCTTGAAGTGCAATCTCGAGATTGCACTTCAAGGTACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000615.1-1537s1c1
Sequence:CCGGCCAAGCTCCAATTACAGCAATCTCGAGATTGCTGTAATTGGAGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000615.1-1536s1c1
Sequence:CCGGGCCAAGCTCCAATTACAGCAACTCGAGTTGCTGTAATTGGAGCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000615.1-693s1c1
Sequence:CCGGCCGATTCATAGTCCTGTCCAACTCGAGTTGGACAGGACTATGAATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000615
VALIDATED
NCAM1 MISSION shRNA Lentiviral Transduction Particles
neural cell adhesion molecule 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000615.5-433s21c1
Sequence:CCGGCAGCGTTGGAGAGTCCAAATTCTCGAGAATTTGGACTCTCCAACGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000615.5-2176s21c1
Sequence:CCGGAGAGGATGGAAACTCTATTAACTCGAGTTAATAGAGTTTCCATCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373034    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000615.5-3168s21c1
Sequence:CCGGCCGTTCCCTGAAACCGTTAAACTCGAGTTTAACGGTTTCAGGGAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073458    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000615.1-2796s1c1
Sequence:CCGGGCTTCACCAGAGCATTTCCAACTCGAGTTGGAAATGCTCTGGTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000615.1-1391s1c1
Sequence:CCGGCCATGTACCTTGAAGTGCAATCTCGAGATTGCACTTCAAGGTACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000615.1-1537s1c1
Sequence:CCGGCCAAGCTCCAATTACAGCAATCTCGAGATTGCTGTAATTGGAGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000615.1-1536s1c1
Sequence:CCGGGCCAAGCTCCAATTACAGCAACTCGAGTTGCTGTAATTGGAGCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000615.1-693s1c1
Sequence:CCGGCCGATTCATAGTCCTGTCCAACTCGAGTTGGACAGGACTATGAATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010875
VALIDATED
NCAM1 MISSION shRNA Bacterial Glycerol Stock
neural cell adhesion molecule 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010875.3-2952s21c1
Sequence:CCGGGATCTTTCTTCCAATACTATTCTCGAGAATAGTATTGGAAGAAAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010875.3-1679s21c1
Sequence:CCGGCCAAGCTCCAACTACAGCAATCTCGAGATTGCTGTAGTTGGAGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010875.3-1924s21c1
Sequence:CCGGCGTGCCCATTCTCAAGTACAACTCGAGTTGTACTTGAGAATGGGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010875.3-436s21c1
Sequence:CCGGCGTTGGAGAGTCCAAATTCTTCTCGAGAAGAATTTGGACTCTCCAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010875.2-597s1c1
Sequence:CCGGCCTCCAACCATCATCTGGAAACTCGAGTTTCCAGATGATGGTTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010875.2-1364s1c1
Sequence:CCGGCGAATTTCAATATGCTCCCAACTCGAGTTGGGAGCATATTGAAATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010875.2-257s1c1
Sequence:CCGGCGTTGGAGAGTCCAAATTCTTCTCGAGAAGAATTTGGACTCTCCAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010875.2-1500s1c1
Sequence:CCGGCCAAGCTCCAACTACAGCAATCTCGAGATTGCTGTAGTTGGAGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010875.2-1745s1c1
Sequence:CCGGCGTGCCCATTCTCAAGTACAACTCGAGTTGTACTTGAGAATGGGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010875
VALIDATED
NCAM1 MISSION shRNA shRNA Plasmid DNA
neural cell adhesion molecule 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010875.3-2952s21c1
Sequence:CCGGGATCTTTCTTCCAATACTATTCTCGAGAATAGTATTGGAAGAAAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010875.3-1679s21c1
Sequence:CCGGCCAAGCTCCAACTACAGCAATCTCGAGATTGCTGTAGTTGGAGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010875.3-1924s21c1
Sequence:CCGGCGTGCCCATTCTCAAGTACAACTCGAGTTGTACTTGAGAATGGGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010875.3-436s21c1
Sequence:CCGGCGTTGGAGAGTCCAAATTCTTCTCGAGAAGAATTTGGACTCTCCAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010875.2-597s1c1
Sequence:CCGGCCTCCAACCATCATCTGGAAACTCGAGTTTCCAGATGATGGTTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010875.2-1364s1c1
Sequence:CCGGCGAATTTCAATATGCTCCCAACTCGAGTTGGGAGCATATTGAAATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010875.2-257s1c1
Sequence:CCGGCGTTGGAGAGTCCAAATTCTTCTCGAGAAGAATTTGGACTCTCCAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010875.2-1500s1c1
Sequence:CCGGCCAAGCTCCAACTACAGCAATCTCGAGATTGCTGTAGTTGGAGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010875.2-1745s1c1
Sequence:CCGGCGTGCCCATTCTCAAGTACAACTCGAGTTGTACTTGAGAATGGGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010875
VALIDATED
NCAM1 MISSION shRNA Lentiviral Transduction Particles
neural cell adhesion molecule 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010875.3-2952s21c1
Sequence:CCGGGATCTTTCTTCCAATACTATTCTCGAGAATAGTATTGGAAGAAAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010875.3-1679s21c1
Sequence:CCGGCCAAGCTCCAACTACAGCAATCTCGAGATTGCTGTAGTTGGAGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010875.3-1924s21c1
Sequence:CCGGCGTGCCCATTCTCAAGTACAACTCGAGTTGTACTTGAGAATGGGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010875.3-436s21c1
Sequence:CCGGCGTTGGAGAGTCCAAATTCTTCTCGAGAAGAATTTGGACTCTCCAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010875.2-597s1c1
Sequence:CCGGCCTCCAACCATCATCTGGAAACTCGAGTTTCCAGATGATGGTTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010875.2-1364s1c1
Sequence:CCGGCGAATTTCAATATGCTCCCAACTCGAGTTGGGAGCATATTGAAATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010875.2-257s1c1
Sequence:CCGGCGTTGGAGAGTCCAAATTCTTCTCGAGAAGAATTTGGACTCTCCAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010875.2-1500s1c1
Sequence:CCGGCCAAGCTCCAACTACAGCAATCTCGAGATTGCTGTAGTTGGAGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010875.2-1745s1c1
Sequence:CCGGCGTGCCCATTCTCAAGTACAACTCGAGTTGTACTTGAGAATGGGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)