EMAIL THIS PAGE TO A FRIEND

NCAM2

neural cell adhesion molecule 2

79 Gene Product Result for
Synonyms: NCAM21
UniProtKB ID: O15394, A8MQ06, Q7Z7F2
Gene ID:
Human(4685) Summary: The protein encoded by this gene belongs to the immunoglobulin superfamily. It is a type I membrane protein and may function in selective fasciculation and zone-to-zone projection of the primary olfactory axons. [provided by RefSeq, Jul 2008]
Mouse(17968) neural cell adhesion molecule 2
Rat(288280) neural cell adhesion molecule 2
Zebrafish(114441) neural cell adhesion molecule 2
chicken(427968) neural cell adhesion molecule 2
dog(487705) neural cell adhesion molecule 2
domestic cat(101087087) neural cell adhesion molecule 2
Horse(100067189) neural cell adhesion molecule 2
cow(535613) neural cell adhesion molecule 2
sheep(101114992) neural cell adhesion molecule 2
Domestic Rabbit(100353943) neural cell adhesion molecule 2
naked mole-rat(101720036) neural cell adhesion molecule 2
domestic guinea pig(100727583) neural cell adhesion molecule 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004540 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004540 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004540 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010954 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010954 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010954 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004540 Rosetta Predictions human pricing
NM_203409 Rosetta Predictions rat pricing
NM_001113208 Rosetta Predictions mouse pricing
NM_010954 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004540 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231480 predicted 1049
2 SASI_Hs01_00231481 predicted 1304
3 SASI_Hs01_00231482 predicted 1503
4 SASI_Hs01_00231483 predicted 2242
5 SASI_Hs01_00231484 predicted 831
6 SASI_Hs01_00231485 predicted 1118
7 SASI_Hs01_00231486 predicted 2249
8 SASI_Hs01_00231487 predicted 1497
9 SASI_Hs01_00231488 predicted 1178
10 SASI_Hs02_00337848 predicted 2387
11 SASI_Hs01_00231479 predicted 2678
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203409 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099973 predicted 240
2 SASI_Rn01_00099975 predicted 1585
3 SASI_Rn01_00099976 predicted 1599
4 SASI_Rn01_00099977 predicted 1676
5 SASI_Rn01_00099978 predicted 329
6 SASI_Rn01_00099979 predicted 2407
7 SASI_Rn02_00270368 predicted 1728
8 SASI_Rn01_00099980 predicted 2132
9 SASI_Rn01_00099981 predicted 317
10 SASI_Rn01_00099982 predicted 2367
11 SASI_Rn01_00099974 predicted 1243
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113208 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307233 predicted 1528
2 SASI_Mm02_00307234 predicted 1447
3 SASI_Mm02_00307235 predicted 1641
4 SASI_Mm02_00307236 predicted 332
5 SASI_Mm02_00307237 predicted 1579
6 SASI_Mm02_00307238 predicted 1314
7 SASI_Mm02_00307239 predicted 1101
8 SASI_Mm02_00307240 predicted 1223
9 SASI_Mm02_00307241 predicted 1715
10 SASI_Mm02_00307242 predicted 1042
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010954 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200320 predicted 1532
2 SASI_Mm02_00319711 predicted 1454
3 SASI_Mm01_00200321 predicted 1638
4 SASI_Mm01_00200323 predicted 331
5 SASI_Mm01_00200324 predicted 1571
6 SASI_Mm01_00200325 predicted 1316
7 SASI_Mm01_00200326 predicted 1105
8 SASI_Mm01_00200327 predicted 1218
9 SASI_Mm01_00200328 predicted 1715
10 SASI_Mm02_00319712 predicted 1041
11 SASI_Mm01_00200322 predicted 2128
12 SASI_Mm01_00200329 predicted 2044
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004540
NCAM2 MISSION shRNA Bacterial Glycerol Stock
neural cell adhesion molecule 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157352    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004540.2-3152s1c1
Sequence:CCGGCCTGCATGTGTATGAGTCCTACTCGAGTAGGACTCATACACATGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004540.2-2454s1c1
Sequence:CCGGCACTAGGAGAATGTGTGGAAACTCGAGTTTCCACACATTCTCCTAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004540.2-2267s1c1
Sequence:CCGGGATATTCTGAACCGACAGTTTCTCGAGAAACTGTCGGTTCAGAATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004540.2-554s1c1
Sequence:CCGGCACAAGAAGCTACAGTAGTTTCTCGAGAAACTACTGTAGCTTCTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004540.2-326s1c1
Sequence:CCGGCACTTAGCAAAGTAGAGCTTACTCGAGTAAGCTCTACTTTGCTAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152382    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004540.2-3280s1c1
Sequence:CCGGGCCAGTTATCTTTAGCAGATACTCGAGTATCTGCTAAAGATAACTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004540.2-2414s1c1
Sequence:CCGGGCTGCTTCTTTATTCGGCAATCTCGAGATTGCCGAATAAAGAAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004540.2-1648s1c1
Sequence:CCGGGACAATGACTTTGGACGCTATCTCGAGATAGCGTCCAAAGTCATTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153236    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004540.2-2251s1c1
Sequence:CCGGGCTGCCAATAGATTGGGATATCTCGAGATATCCCAATCTATTGGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004540.2-3128s1c1
Sequence:CCGGCGTGAGCTACATGTGTAAGAACTCGAGTTCTTACACATGTAGCTCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004540
NCAM2 MISSION shRNA shRNA Plasmid DNA
neural cell adhesion molecule 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157352    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004540.2-3152s1c1
Sequence:CCGGCCTGCATGTGTATGAGTCCTACTCGAGTAGGACTCATACACATGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004540.2-2454s1c1
Sequence:CCGGCACTAGGAGAATGTGTGGAAACTCGAGTTTCCACACATTCTCCTAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004540.2-2267s1c1
Sequence:CCGGGATATTCTGAACCGACAGTTTCTCGAGAAACTGTCGGTTCAGAATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004540.2-554s1c1
Sequence:CCGGCACAAGAAGCTACAGTAGTTTCTCGAGAAACTACTGTAGCTTCTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004540.2-326s1c1
Sequence:CCGGCACTTAGCAAAGTAGAGCTTACTCGAGTAAGCTCTACTTTGCTAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152382    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004540.2-3280s1c1
Sequence:CCGGGCCAGTTATCTTTAGCAGATACTCGAGTATCTGCTAAAGATAACTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004540.2-2414s1c1
Sequence:CCGGGCTGCTTCTTTATTCGGCAATCTCGAGATTGCCGAATAAAGAAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004540.2-1648s1c1
Sequence:CCGGGACAATGACTTTGGACGCTATCTCGAGATAGCGTCCAAAGTCATTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153236    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004540.2-2251s1c1
Sequence:CCGGGCTGCCAATAGATTGGGATATCTCGAGATATCCCAATCTATTGGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004540.2-3128s1c1
Sequence:CCGGCGTGAGCTACATGTGTAAGAACTCGAGTTCTTACACATGTAGCTCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004540
NCAM2 MISSION shRNA Lentiviral Transduction Particles
neural cell adhesion molecule 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157352    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004540.2-3152s1c1
Sequence:CCGGCCTGCATGTGTATGAGTCCTACTCGAGTAGGACTCATACACATGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004540.2-2454s1c1
Sequence:CCGGCACTAGGAGAATGTGTGGAAACTCGAGTTTCCACACATTCTCCTAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004540.2-2267s1c1
Sequence:CCGGGATATTCTGAACCGACAGTTTCTCGAGAAACTGTCGGTTCAGAATATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004540.2-554s1c1
Sequence:CCGGCACAAGAAGCTACAGTAGTTTCTCGAGAAACTACTGTAGCTTCTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004540.2-326s1c1
Sequence:CCGGCACTTAGCAAAGTAGAGCTTACTCGAGTAAGCTCTACTTTGCTAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152382    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004540.2-3280s1c1
Sequence:CCGGGCCAGTTATCTTTAGCAGATACTCGAGTATCTGCTAAAGATAACTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004540.2-2414s1c1
Sequence:CCGGGCTGCTTCTTTATTCGGCAATCTCGAGATTGCCGAATAAAGAAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004540.2-1648s1c1
Sequence:CCGGGACAATGACTTTGGACGCTATCTCGAGATAGCGTCCAAAGTCATTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153236    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004540.2-2251s1c1
Sequence:CCGGGCTGCCAATAGATTGGGATATCTCGAGATATCCCAATCTATTGGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004540.2-3128s1c1
Sequence:CCGGCGTGAGCTACATGTGTAAGAACTCGAGTTCTTACACATGTAGCTCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010954
NCAM2 MISSION shRNA Bacterial Glycerol Stock
neural cell adhesion molecule 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010954.2-4409s1c1
Sequence:CCGGGCCCTGTGATAAGGAAATCATCTCGAGATGATTTCCTTATCACAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010954.2-1588s1c1
Sequence:CCGGGCACAAGATTTCAGGAATATACTCGAGTATATTCCTGAAATCTTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010954.2-1467s1c1
Sequence:CCGGCCAGCTAAGAATACGACTCATCTCGAGATGAGTCGTATTCTTAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010954.2-335s1c1
Sequence:CCGGGCAGAGGGTTATGCTACAGAACTCGAGTTCTGTAGCATAACCCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010954.2-1341s1c1
Sequence:CCGGGCTCCTAAGTTTGTTTCAAATCTCGAGATTTGAAACAAACTTAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010954.4-1267s21c1
Sequence:CCGGGGATGGCCGCATCGAAGTTAACTCGAGTTAACTTCGATGCGGCCATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434103    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010954.4-2875s21c1
Sequence:CCGGCATAAGCTTGATACCCTATTACTCGAGTAATAGGGTATCAAGCTTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010954.4-2152s21c1
Sequence:CCGGGGGAAATAAAGACCACATTATCTCGAGATAATGTGGTCTTTATTTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010954
NCAM2 MISSION shRNA shRNA Plasmid DNA
neural cell adhesion molecule 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010954.2-4409s1c1
Sequence:CCGGGCCCTGTGATAAGGAAATCATCTCGAGATGATTTCCTTATCACAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010954.2-1588s1c1
Sequence:CCGGGCACAAGATTTCAGGAATATACTCGAGTATATTCCTGAAATCTTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010954.2-1467s1c1
Sequence:CCGGCCAGCTAAGAATACGACTCATCTCGAGATGAGTCGTATTCTTAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010954.2-335s1c1
Sequence:CCGGGCAGAGGGTTATGCTACAGAACTCGAGTTCTGTAGCATAACCCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010954.2-1341s1c1
Sequence:CCGGGCTCCTAAGTTTGTTTCAAATCTCGAGATTTGAAACAAACTTAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010954.4-1267s21c1
Sequence:CCGGGGATGGCCGCATCGAAGTTAACTCGAGTTAACTTCGATGCGGCCATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434103    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010954.4-2875s21c1
Sequence:CCGGCATAAGCTTGATACCCTATTACTCGAGTAATAGGGTATCAAGCTTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010954.4-2152s21c1
Sequence:CCGGGGGAAATAAAGACCACATTATCTCGAGATAATGTGGTCTTTATTTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010954
NCAM2 MISSION shRNA Lentiviral Transduction Particles
neural cell adhesion molecule 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010954.2-4409s1c1
Sequence:CCGGGCCCTGTGATAAGGAAATCATCTCGAGATGATTTCCTTATCACAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010954.2-1588s1c1
Sequence:CCGGGCACAAGATTTCAGGAATATACTCGAGTATATTCCTGAAATCTTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010954.2-1467s1c1
Sequence:CCGGCCAGCTAAGAATACGACTCATCTCGAGATGAGTCGTATTCTTAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010954.2-335s1c1
Sequence:CCGGGCAGAGGGTTATGCTACAGAACTCGAGTTCTGTAGCATAACCCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010954.2-1341s1c1
Sequence:CCGGGCTCCTAAGTTTGTTTCAAATCTCGAGATTTGAAACAAACTTAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010954.4-1267s21c1
Sequence:CCGGGGATGGCCGCATCGAAGTTAACTCGAGTTAACTTCGATGCGGCCATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434103    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010954.4-2875s21c1
Sequence:CCGGCATAAGCTTGATACCCTATTACTCGAGTAATAGGGTATCAAGCTTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010954.4-2152s21c1
Sequence:CCGGGGGAAATAAAGACCACATTATCTCGAGATAATGTGGTCTTTATTTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)