EMAIL THIS PAGE TO A FRIEND

NCAN

neurocan

89 Gene Product Result for
Synonyms: CSPG3
UniProtKB ID: O14594, Q9UPK6
Gene ID:
Human(1463) Summary: Neurocan is a chondroitin sulfate proteoglycan thought to be involved in the modulation of cell adhesion and migration.[supplied by OMIM, Jul 2002]
Mouse(13004) neurocan
Rat(58982) neurocan
sheep(101105820) neurocan
chicken(395493) neurocan
dog(484808) neurocan
cow(523701) neurocan
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004386 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004386 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004386 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007789 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007789 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007789 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004386 Rosetta Predictions human pricing
NM_031653 Rosetta Predictions rat pricing
NM_007789 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004386 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192498 predicted 3369
2 SASI_Hs01_00192499 predicted 3576
3 SASI_Hs01_00192501 predicted 2289
4 SASI_Hs01_00192502 predicted 3598
5 SASI_Hs01_00192503 predicted 3150
6 SASI_Hs01_00192504 predicted 668
7 SASI_Hs01_00192505 predicted 2051
8 SASI_Hs02_00337494 predicted 2641
9 SASI_Hs01_00192506 predicted 3126
10 SASI_Hs01_00192507 predicted 3696
11 SASI_Hs01_00192500 predicted 3127
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031653 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043897 predicted 3692
2 SASI_Rn01_00043898 predicted 3372
3 SASI_Rn01_00043900 predicted 1994
4 SASI_Rn01_00043901 predicted 281
5 SASI_Rn01_00043902 predicted 1067
6 SASI_Rn01_00043903 predicted 3366
7 SASI_Rn02_00264987 predicted 3018
8 SASI_Rn01_00043904 predicted 1697
9 SASI_Rn01_00043906 predicted 1916
10 SASI_Rn02_00264988 predicted 2465
11 SASI_Rn01_00043899 predicted 2971
12 SASI_Rn01_00043905 predicted 303
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007789 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312468 predicted 3450
2 SASI_Mm02_00312469 predicted 3778
3 SASI_Mm02_00312470 predicted 2337
4 SASI_Mm02_00312471 predicted 3737
5 SASI_Mm02_00312472 predicted 1325
6 SASI_Mm02_00312473 predicted 330
7 SASI_Mm02_00312474 predicted 1756
8 SASI_Mm02_00312475 predicted 2878
9 SASI_Mm02_00312476 predicted 3095
10 SASI_Mm02_00312477 predicted 354
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004386
NCAN MISSION shRNA Bacterial Glycerol Stock
neurocan
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004386.1-1961s1c1
Sequence:CCGGGCCAATAGAGTTGAGGCACATCTCGAGATGTGCCTCAACTCTATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004386.2-3610s21c1
Sequence:CCGGGAGAACCAGCCGGACAATTTCCTCGAGGAAATTGTCCGGCTGGTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004386.2-3578s21c1
Sequence:CCGGACAACACCGGGCTGCAATTTGCTCGAGCAAATTGCAGCCCGGTGTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004386.1-3048s1c1
Sequence:CCGGCTTGTCTTCATGGAGGGACATCTCGAGATGTCCCTCCATGAAGACAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004386.1-2511s1c1
Sequence:CCGGCCAGTGATGCTAGTGGAATTTCTCGAGAAATTCCACTAGCATCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004386.1-3599s1c1
Sequence:CCGGTGCAACTACAACCTACCCTATCTCGAGATAGGGTAGGTTGTAGTTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004386.1-590s1c1
Sequence:CCGGGCTGCCTTTGAGGATGGCTTTCTCGAGAAAGCCATCCTCAAAGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004386.2-4447s21c1
Sequence:CCGGGAAATTCAGACTTAGTCAATGCTCGAGCATTGACTAAGTCTGAATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414769    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004386.2-4346s21c1
Sequence:CCGGATTGGTCTGGTCTCTTGTTTGCTCGAGCAAACAAGAGACCAGACCAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004386
NCAN MISSION shRNA shRNA Plasmid DNA
neurocan
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004386.1-1961s1c1
Sequence:CCGGGCCAATAGAGTTGAGGCACATCTCGAGATGTGCCTCAACTCTATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004386.2-3610s21c1
Sequence:CCGGGAGAACCAGCCGGACAATTTCCTCGAGGAAATTGTCCGGCTGGTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004386.2-3578s21c1
Sequence:CCGGACAACACCGGGCTGCAATTTGCTCGAGCAAATTGCAGCCCGGTGTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004386.1-3048s1c1
Sequence:CCGGCTTGTCTTCATGGAGGGACATCTCGAGATGTCCCTCCATGAAGACAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004386.1-2511s1c1
Sequence:CCGGCCAGTGATGCTAGTGGAATTTCTCGAGAAATTCCACTAGCATCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004386.1-3599s1c1
Sequence:CCGGTGCAACTACAACCTACCCTATCTCGAGATAGGGTAGGTTGTAGTTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004386.1-590s1c1
Sequence:CCGGGCTGCCTTTGAGGATGGCTTTCTCGAGAAAGCCATCCTCAAAGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004386.2-4447s21c1
Sequence:CCGGGAAATTCAGACTTAGTCAATGCTCGAGCATTGACTAAGTCTGAATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414769    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004386.2-4346s21c1
Sequence:CCGGATTGGTCTGGTCTCTTGTTTGCTCGAGCAAACAAGAGACCAGACCAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004386
NCAN MISSION shRNA Lentiviral Transduction Particles
neurocan
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004386.1-1961s1c1
Sequence:CCGGGCCAATAGAGTTGAGGCACATCTCGAGATGTGCCTCAACTCTATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004386.2-3610s21c1
Sequence:CCGGGAGAACCAGCCGGACAATTTCCTCGAGGAAATTGTCCGGCTGGTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004386.2-3578s21c1
Sequence:CCGGACAACACCGGGCTGCAATTTGCTCGAGCAAATTGCAGCCCGGTGTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004386.1-3048s1c1
Sequence:CCGGCTTGTCTTCATGGAGGGACATCTCGAGATGTCCCTCCATGAAGACAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004386.1-2511s1c1
Sequence:CCGGCCAGTGATGCTAGTGGAATTTCTCGAGAAATTCCACTAGCATCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004386.1-3599s1c1
Sequence:CCGGTGCAACTACAACCTACCCTATCTCGAGATAGGGTAGGTTGTAGTTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004386.1-590s1c1
Sequence:CCGGGCTGCCTTTGAGGATGGCTTTCTCGAGAAAGCCATCCTCAAAGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004386.2-4447s21c1
Sequence:CCGGGAAATTCAGACTTAGTCAATGCTCGAGCATTGACTAAGTCTGAATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414769    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004386.2-4346s21c1
Sequence:CCGGATTGGTCTGGTCTCTTGTTTGCTCGAGCAAACAAGAGACCAGACCAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007789
NCAN MISSION shRNA Bacterial Glycerol Stock
neurocan
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007789.2-3744s1c1
Sequence:CCGGGCCTCAGATCATGTGCATCAACTCGAGTTGATGCACATGATCTGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007789.3-321s21c1
Sequence:CCGGTAAGCTCCCTGCGAGACATTCCTCGAGGAATGTCTCGCAGGGAGCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007789.3-3132s21c1
Sequence:CCGGTATGCAGCCCTTGCGAGAATGCTCGAGCATTCTCGCAAGGGCTGCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007789.3-594s21c1
Sequence:CCGGCAGGCGTCGTGTTCCATTATCCTCGAGGATAATGGAACACGACGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007789.2-1336s1c1
Sequence:CCGGCCAGACTTGACTTGGACACAACTCGAGTTGTGTCCAAGTCAAGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007789.2-1470s1c1
Sequence:CCGGCAGCGACATGGGAGTAGATATCTCGAGATATCTACTCCCATGTCGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007789.3-2343s21c1
Sequence:CCGGCTAGTAATGTGACGATGAATCCTCGAGGATTCATCGTCACATTACTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007789.3-1504s21c1
Sequence:CCGGCAGCGACATGGGAGTAGATATCTCGAGATATCTACTCCCATGTCGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007789
NCAN MISSION shRNA shRNA Plasmid DNA
neurocan
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007789.2-3744s1c1
Sequence:CCGGGCCTCAGATCATGTGCATCAACTCGAGTTGATGCACATGATCTGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007789.3-321s21c1
Sequence:CCGGTAAGCTCCCTGCGAGACATTCCTCGAGGAATGTCTCGCAGGGAGCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007789.3-3132s21c1
Sequence:CCGGTATGCAGCCCTTGCGAGAATGCTCGAGCATTCTCGCAAGGGCTGCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007789.3-594s21c1
Sequence:CCGGCAGGCGTCGTGTTCCATTATCCTCGAGGATAATGGAACACGACGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007789.2-1336s1c1
Sequence:CCGGCCAGACTTGACTTGGACACAACTCGAGTTGTGTCCAAGTCAAGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007789.2-1470s1c1
Sequence:CCGGCAGCGACATGGGAGTAGATATCTCGAGATATCTACTCCCATGTCGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007789.3-2343s21c1
Sequence:CCGGCTAGTAATGTGACGATGAATCCTCGAGGATTCATCGTCACATTACTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007789.3-1504s21c1
Sequence:CCGGCAGCGACATGGGAGTAGATATCTCGAGATATCTACTCCCATGTCGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007789
NCAN MISSION shRNA Lentiviral Transduction Particles
neurocan
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007789.2-3744s1c1
Sequence:CCGGGCCTCAGATCATGTGCATCAACTCGAGTTGATGCACATGATCTGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007789.3-321s21c1
Sequence:CCGGTAAGCTCCCTGCGAGACATTCCTCGAGGAATGTCTCGCAGGGAGCTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007789.3-3132s21c1
Sequence:CCGGTATGCAGCCCTTGCGAGAATGCTCGAGCATTCTCGCAAGGGCTGCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007789.3-594s21c1
Sequence:CCGGCAGGCGTCGTGTTCCATTATCCTCGAGGATAATGGAACACGACGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007789.2-1336s1c1
Sequence:CCGGCCAGACTTGACTTGGACACAACTCGAGTTGTGTCCAAGTCAAGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007789.2-1470s1c1
Sequence:CCGGCAGCGACATGGGAGTAGATATCTCGAGATATCTACTCCCATGTCGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007789.3-2343s21c1
Sequence:CCGGCTAGTAATGTGACGATGAATCCTCGAGGATTCATCGTCACATTACTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007789.3-1504s21c1
Sequence:CCGGCAGCGACATGGGAGTAGATATCTCGAGATATCTACTCCCATGTCGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)