EMAIL THIS PAGE TO A FRIEND

NCAPD2

non-SMC condensin I complex, subunit D2

59 Gene Product Result for
Synonyms: CAP-D2 CNAP1 hCAP-D2
UniProtKB ID: Q15021, D3DUR4, Q8N6U3
Gene ID:
Mouse(68298) non-SMC condensin I complex, subunit D2
Rat(362438) non-SMC condensin I complex, subunit D2
Zebrafish(552978) non-SMC condensin I complex, subunit D2
chicken(418275) non-SMC condensin I complex, subunit D2
domestic cat(101092372) non-SMC condensin I complex, subunit D2
cow(509171) uncharacterized LOC509171
Horse(100059757) non-SMC condensin I complex, subunit D2
dog(477715) non-SMC condensin I complex, subunit D2
cow(786159) non-SMC condensin I complex, subunit D2
sheep(101113225) non-SMC condensin I complex, subunit D2
naked mole-rat(101702538) non-SMC condensin I complex, subunit D2
Domestic Rabbit(100357645) non-SMC condensin I complex, subunit D2
domestic guinea pig(100728940) non-SMC condensin I complex, subunit D2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014865 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014865 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014865 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146171 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146171 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146171 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014865 Rosetta Predictions human pricing
XM_001065923 Rosetta Predictions rat pricing
XM_575668 Rosetta Predictions rat pricing
NM_146171 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014865 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346452 predicted 2180
2 SASI_Hs01_00044257 predicted 614
3 SASI_Hs01_00044258 predicted 860
4 SASI_Hs01_00044259 predicted 2234
5 SASI_Hs02_00346453 predicted 3525
6 SASI_Hs02_00346454 predicted 3792
7 SASI_Hs01_00044260 predicted 1800
8 SASI_Hs01_00044262 predicted 4041
9 SASI_Hs01_00044263 predicted 2244
10 SASI_Hs01_00044264 predicted 1259
11 SASI_Hs01_00044256 predicted 292
12 SASI_Hs01_00044261 predicted 411
13 SASI_Hs01_00044265 predicted 1605
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065923 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00315735 predicted 2627
2 SASI_Rn02_00315736 predicted 1094
3 SASI_Rn02_00315737 predicted 565
4 SASI_Rn02_00315738 predicted 949
5 SASI_Rn02_00315739 predicted 3991
6 SASI_Rn02_00315740 predicted 4145
7 SASI_Rn02_00315741 predicted 1874
8 SASI_Rn02_00315742 predicted 3833
9 SASI_Rn02_00315743 predicted 223
10 SASI_Rn02_00315744 predicted 2035
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575668 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00404057 predicted 2628
2 SASI_Rn02_00404058 predicted 1095
3 SASI_Rn02_00404059 predicted 566
4 SASI_Rn02_00404060 predicted 954
5 SASI_Rn02_00404061 predicted 3991
6 SASI_Rn02_00404062 predicted 4144
7 SASI_Rn02_00404063 predicted 1882
8 SASI_Rn02_00404064 predicted 3839
9 SASI_Rn02_00404065 predicted 224
10 SASI_Rn02_00404066 predicted 2041
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146171 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027523 predicted 4108
2 SASI_Mm01_00027525 predicted 2267
3 SASI_Mm01_00027526 predicted 2038
4 SASI_Mm01_00027527 predicted 1602
5 SASI_Mm01_00027528 predicted 926
6 SASI_Mm01_00027529 predicted 1348
7 SASI_Mm01_00027530 predicted 217
8 SASI_Mm01_00027531 predicted 2620
9 SASI_Mm02_00341872 predicted 2429
10 SASI_Mm01_00027532 predicted 2007
11 SASI_Mm01_00027524 predicted 575
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014865
VALIDATED
NCAPD2 MISSION shRNA Bacterial Glycerol Stock
non-SMC condensin I complex, subunit D2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115682    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014865.2-4319s1c1
Sequence:CCGGCGAATTCTGTTTCCCTTGTAACTCGAGTTACAAGGGAAACAGAATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_014865.2-2414s1c1
Sequence:CCGGCCAGAAATTGTGGGAAGCAATCTCGAGATTGCTTCCCACAATTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014865.2-3776s1c1
Sequence:CCGGCTCCGTAAGATGCTTGACAATCTCGAGATTGTCAAGCATCTTACGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_014865.2-439s1c1
Sequence:CCGGCCTGGAATCCTTTGAGACCATCTCGAGATGGTCTCAAAGGATTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_014865.2-3775s1c1
Sequence:CCGGCCTCCGTAAGATGCTTGACAACTCGAGTTGTCAAGCATCTTACGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014865.3-245s21c1
Sequence:CCGGTTGCATCACTTTCGAAGTATACTCGAGTATACTTCGAAAGTGATGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014865.3-593s21c1
Sequence:CCGGCACCTGTGGAACCACTCAATACTCGAGTATTGAGTGGTTCCACAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014865.3-3871s21c1
Sequence:CCGGGCCTGAGGGCAAGGCTATAATCTCGAGATTATAGCCTTGCCCTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244238    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014865.3-4630s21c1
Sequence:CCGGGCGAACCTCCATCTCAAATTACTCGAGTAATTTGAGATGGAGGTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014865.3-730s21c1
Sequence:CCGGTGTAGCCTTGACCCGTTATAACTCGAGTTATAACGGGTCAAGGCTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014865
VALIDATED
NCAPD2 MISSION shRNA shRNA Plasmid DNA
non-SMC condensin I complex, subunit D2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115682    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014865.2-4319s1c1
Sequence:CCGGCGAATTCTGTTTCCCTTGTAACTCGAGTTACAAGGGAAACAGAATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_014865.2-2414s1c1
Sequence:CCGGCCAGAAATTGTGGGAAGCAATCTCGAGATTGCTTCCCACAATTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014865.2-3776s1c1
Sequence:CCGGCTCCGTAAGATGCTTGACAATCTCGAGATTGTCAAGCATCTTACGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_014865.2-439s1c1
Sequence:CCGGCCTGGAATCCTTTGAGACCATCTCGAGATGGTCTCAAAGGATTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_014865.2-3775s1c1
Sequence:CCGGCCTCCGTAAGATGCTTGACAACTCGAGTTGTCAAGCATCTTACGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014865.3-245s21c1
Sequence:CCGGTTGCATCACTTTCGAAGTATACTCGAGTATACTTCGAAAGTGATGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014865.3-593s21c1
Sequence:CCGGCACCTGTGGAACCACTCAATACTCGAGTATTGAGTGGTTCCACAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014865.3-3871s21c1
Sequence:CCGGGCCTGAGGGCAAGGCTATAATCTCGAGATTATAGCCTTGCCCTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244238    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014865.3-4630s21c1
Sequence:CCGGGCGAACCTCCATCTCAAATTACTCGAGTAATTTGAGATGGAGGTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014865.3-730s21c1
Sequence:CCGGTGTAGCCTTGACCCGTTATAACTCGAGTTATAACGGGTCAAGGCTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014865
VALIDATED
NCAPD2 MISSION shRNA Lentiviral Transduction Particles
non-SMC condensin I complex, subunit D2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115682    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014865.2-4319s1c1
Sequence:CCGGCGAATTCTGTTTCCCTTGTAACTCGAGTTACAAGGGAAACAGAATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_014865.2-2414s1c1
Sequence:CCGGCCAGAAATTGTGGGAAGCAATCTCGAGATTGCTTCCCACAATTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014865.2-3776s1c1
Sequence:CCGGCTCCGTAAGATGCTTGACAATCTCGAGATTGTCAAGCATCTTACGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_014865.2-439s1c1
Sequence:CCGGCCTGGAATCCTTTGAGACCATCTCGAGATGGTCTCAAAGGATTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_014865.2-3775s1c1
Sequence:CCGGCCTCCGTAAGATGCTTGACAACTCGAGTTGTCAAGCATCTTACGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014865.3-245s21c1
Sequence:CCGGTTGCATCACTTTCGAAGTATACTCGAGTATACTTCGAAAGTGATGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014865.3-593s21c1
Sequence:CCGGCACCTGTGGAACCACTCAATACTCGAGTATTGAGTGGTTCCACAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014865.3-3871s21c1
Sequence:CCGGGCCTGAGGGCAAGGCTATAATCTCGAGATTATAGCCTTGCCCTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244238    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014865.3-4630s21c1
Sequence:CCGGGCGAACCTCCATCTCAAATTACTCGAGTAATTTGAGATGGAGGTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014865.3-730s21c1
Sequence:CCGGTGTAGCCTTGACCCGTTATAACTCGAGTTATAACGGGTCAAGGCTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146171
NCAPD2 MISSION shRNA Bacterial Glycerol Stock
non-SMC condensin I complex, subunit D2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146171.1-3911s1c1
Sequence:CCGGGCAAGGCTATAATAGATGAATCTCGAGATTCATCTATTATAGCCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146171.1-3116s1c1
Sequence:CCGGCCTTTGTTCCACTGCTACTTACTCGAGTAAGTAGCAGTGGAACAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146171.1-1681s1c1
Sequence:CCGGGCAAGTTACAAACAGGCTATTCTCGAGAATAGCCTGTTTGTAACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146171.1-1393s1c1
Sequence:CCGGGCCAGCTTTCTAGCCAATAATCTCGAGATTATTGGCTAGAAAGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110225    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146171.1-4321s1c1
Sequence:CCGGCAGGGTATCTTACTGGATGATCTCGAGATCATCCAGTAAGATACCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146171
NCAPD2 MISSION shRNA shRNA Plasmid DNA
non-SMC condensin I complex, subunit D2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146171.1-3911s1c1
Sequence:CCGGGCAAGGCTATAATAGATGAATCTCGAGATTCATCTATTATAGCCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146171.1-3116s1c1
Sequence:CCGGCCTTTGTTCCACTGCTACTTACTCGAGTAAGTAGCAGTGGAACAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146171.1-1681s1c1
Sequence:CCGGGCAAGTTACAAACAGGCTATTCTCGAGAATAGCCTGTTTGTAACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146171.1-1393s1c1
Sequence:CCGGGCCAGCTTTCTAGCCAATAATCTCGAGATTATTGGCTAGAAAGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110225    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146171.1-4321s1c1
Sequence:CCGGCAGGGTATCTTACTGGATGATCTCGAGATCATCCAGTAAGATACCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146171
NCAPD2 MISSION shRNA Lentiviral Transduction Particles
non-SMC condensin I complex, subunit D2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146171.1-3911s1c1
Sequence:CCGGGCAAGGCTATAATAGATGAATCTCGAGATTCATCTATTATAGCCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146171.1-3116s1c1
Sequence:CCGGCCTTTGTTCCACTGCTACTTACTCGAGTAAGTAGCAGTGGAACAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146171.1-1681s1c1
Sequence:CCGGGCAAGTTACAAACAGGCTATTCTCGAGAATAGCCTGTTTGTAACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146171.1-1393s1c1
Sequence:CCGGGCCAGCTTTCTAGCCAATAATCTCGAGATTATTGGCTAGAAAGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110225    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146171.1-4321s1c1
Sequence:CCGGCAGGGTATCTTACTGGATGATCTCGAGATCATCCAGTAAGATACCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)