EMAIL THIS PAGE TO A FRIEND

NCAPG

non-SMC condensin I complex, subunit G

56 Gene Product Result for
Synonyms: CAPG CHCG NY-MEL-3
Gene ID:
Human(64151) Summary: This gene encodes a subunit of the condensin complex, which is responsible for the condensation and stabilization of chromosomes during mitosis and meiosis. Phosphorylation of the encoded protein activates the condensin complex. There are pseudogenes for this gene on chromosomes 8 and 15. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Mouse(54392) non-SMC condensin I complex, subunit G
Rat(305392) non-SMC condensin I complex, subunit G
sheep(101121775) non-SMC condensin I complex, subunit G
naked mole-rat(101710676) non-SMC condensin I complex, subunit G
Domestic Rabbit(100347720) non-SMC condensin I complex, subunit G
domestic guinea pig(100718184) non-SMC condensin I complex, subunit G
Zebrafish(492707) non-SMC condensin I complex, subunit G
cow(531234) non-SMC condensin I complex, subunit G
Horse(100068609) non-SMC condensin I complex, subunit G
domestic cat(101085544) non-SMC condensin I complex, subunit G
dog(479132) non-SMC condensin I complex, subunit G
chicken(422822) non-SMC condensin I complex, subunit G
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022346 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022346 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022346 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU156161 MISSION® esiRNA esiRNA human HCAP-G (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022346 Rosetta Predictions human pricing
XM_001058724 Rosetta Predictions rat pricing
XM_223468 Rosetta Predictions rat pricing
NM_019438 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022346 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194353 predicted 2462
2 SASI_Hs01_00194354 predicted 2348
3 SASI_Hs02_00355630 predicted 3006
4 SASI_Hs01_00194356 predicted 689
5 SASI_Hs02_00355631 predicted 932
6 SASI_Hs02_00355632 predicted 919
7 SASI_Hs01_00194358 predicted 1481
8 SASI_Hs01_00194359 predicted 1509
9 SASI_Hs01_00194362 predicted 502
10 SASI_Hs02_00355633 predicted 2113
11 SASI_Hs01_00194355 predicted 757
12 SASI_Hs01_00194357 predicted 2910
13 SASI_Hs01_00194360 predicted 1306
14 SASI_Hs01_00194361 predicted 2048
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058724 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00290669 predicted 2208
2 SASI_Rn02_00290670 predicted 262
3 SASI_Rn02_00290671 predicted 2276
4 SASI_Rn02_00290672 predicted 3039
5 SASI_Rn02_00290673 predicted 2164
6 SASI_Rn02_00290674 predicted 2236
7 SASI_Rn02_00290675 predicted 2411
8 SASI_Rn02_00290676 predicted 2731
9 SASI_Rn02_00290677 predicted 3000
10 SASI_Rn02_00290678 predicted 1095
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223468 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381407 predicted 263
2 SASI_Rn02_00381408 predicted 3047
3 SASI_Rn02_00381409 predicted 3026
4 SASI_Rn02_00381410 predicted 714
5 SASI_Rn02_00381411 predicted 392
6 SASI_Rn02_00381412 predicted 650
7 SASI_Rn02_00381413 predicted 964
8 SASI_Rn02_00381414 predicted 901
9 SASI_Rn02_00381415 predicted 2723
10 SASI_Rn02_00381416 predicted 3003
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019438 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324386 predicted 2644
2 SASI_Mm02_00324387 predicted 2270
3 SASI_Mm02_00324388 predicted 2379
4 SASI_Mm02_00324389 predicted 617
5 SASI_Mm02_00324390 predicted 2504
6 SASI_Mm02_00324391 predicted 678
7 SASI_Mm02_00324392 predicted 2544
8 SASI_Mm02_00324393 predicted 2333
9 SASI_Mm02_00324394 predicted 1185
10 SASI_Mm02_00324395 predicted 1498
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022346
VALIDATED
NCAPG MISSION shRNA Bacterial Glycerol Stock
non-SMC condensin I complex, subunit G
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022346.2-765s1c1
Sequence:CCGGCGGGCAGTGTTATCATGTATTCTCGAGAATACATGATAACACTGCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022346.2-502s1c1
Sequence:CCGGCAAACAGCAATGCAGTGAGATCTCGAGATCTCACTGCATTGCTGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022346.2-966s1c1
Sequence:CCGGGCTATGCAGAAGCATCTTCTTCTCGAGAAGAAGATGCTTCTGCATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022346.2-2643s1c1
Sequence:CCGGGCCTTAACAGTACATGACAATCTCGAGATTGTCATGTACTGTTAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022346.2-1812s1c1
Sequence:CCGGGAAGTCCACATAGAGAAGAATCTCGAGATTCTTCTCTATGTGGACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022346.3-765s21c1
Sequence:CCGGCGGGCAGTGTTATCATGTATTCTCGAGAATACATGATAACACTGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022346.3-2643s21c1
Sequence:CCGGGCCTTAACAGTACATGACAATCTCGAGATTGTCATGTACTGTTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022346.3-966s21c1
Sequence:CCGGGCTATGCAGAAGCATCTTCTTCTCGAGAAGAAGATGCTTCTGCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022346.3-1812s21c1
Sequence:CCGGGAAGTCCACATAGAGAAGAATCTCGAGATTCTTCTCTATGTGGACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022346
VALIDATED
NCAPG MISSION shRNA shRNA Plasmid DNA
non-SMC condensin I complex, subunit G
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022346.2-765s1c1
Sequence:CCGGCGGGCAGTGTTATCATGTATTCTCGAGAATACATGATAACACTGCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022346.2-502s1c1
Sequence:CCGGCAAACAGCAATGCAGTGAGATCTCGAGATCTCACTGCATTGCTGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022346.2-966s1c1
Sequence:CCGGGCTATGCAGAAGCATCTTCTTCTCGAGAAGAAGATGCTTCTGCATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022346.2-2643s1c1
Sequence:CCGGGCCTTAACAGTACATGACAATCTCGAGATTGTCATGTACTGTTAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022346.2-1812s1c1
Sequence:CCGGGAAGTCCACATAGAGAAGAATCTCGAGATTCTTCTCTATGTGGACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022346.3-765s21c1
Sequence:CCGGCGGGCAGTGTTATCATGTATTCTCGAGAATACATGATAACACTGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022346.3-2643s21c1
Sequence:CCGGGCCTTAACAGTACATGACAATCTCGAGATTGTCATGTACTGTTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022346.3-966s21c1
Sequence:CCGGGCTATGCAGAAGCATCTTCTTCTCGAGAAGAAGATGCTTCTGCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022346.3-1812s21c1
Sequence:CCGGGAAGTCCACATAGAGAAGAATCTCGAGATTCTTCTCTATGTGGACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022346
VALIDATED
NCAPG MISSION shRNA Lentiviral Transduction Particles
non-SMC condensin I complex, subunit G
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022346.2-765s1c1
Sequence:CCGGCGGGCAGTGTTATCATGTATTCTCGAGAATACATGATAACACTGCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022346.2-502s1c1
Sequence:CCGGCAAACAGCAATGCAGTGAGATCTCGAGATCTCACTGCATTGCTGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022346.2-966s1c1
Sequence:CCGGGCTATGCAGAAGCATCTTCTTCTCGAGAAGAAGATGCTTCTGCATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022346.2-2643s1c1
Sequence:CCGGGCCTTAACAGTACATGACAATCTCGAGATTGTCATGTACTGTTAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022346.2-1812s1c1
Sequence:CCGGGAAGTCCACATAGAGAAGAATCTCGAGATTCTTCTCTATGTGGACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022346.3-765s21c1
Sequence:CCGGCGGGCAGTGTTATCATGTATTCTCGAGAATACATGATAACACTGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022346.3-2643s21c1
Sequence:CCGGGCCTTAACAGTACATGACAATCTCGAGATTGTCATGTACTGTTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022346.3-966s21c1
Sequence:CCGGGCTATGCAGAAGCATCTTCTTCTCGAGAAGAAGATGCTTCTGCATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022346.3-1812s21c1
Sequence:CCGGGAAGTCCACATAGAGAAGAATCTCGAGATTCTTCTCTATGTGGACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)