EMAIL THIS PAGE TO A FRIEND

NCAPH2

non-SMC condensin II complex, subunit H2

98 Gene Product Result for
Synonyms: CAPH2
Gene ID:
Human(29781) Summary: This gene encodes one of the non-SMC subunits of the condensin II complex. This complex plays an essential role in mitotic chromosome assembly. Alternate splicing of this gene results in multiple transcript variants.[provided by RefSeq, May 2010]
Mouse(52683) non-SMC condensin II complex, subunit H2
Rat(300149) non-SMC condensin II complex, subunit H2
Zebrafish(562678) non-SMC condensin II complex, subunit H2
cow(767978) non-SMC condensin II complex, subunit H2
Horse(100056669) non-SMC condensin II complex, subunit H2
domestic cat(101082421) non-SMC condensin II complex, subunit H2
dog(474458) non-SMC condensin II complex, subunit H2
chicken(426276) non-SMC condensin II complex, subunit H2
domestic guinea pig(100719084) non-SMC condensin II complex, subunit H2
naked mole-rat(101699187) non-SMC condensin II complex, subunit H2
sheep(101117751) non-SMC condensin II complex, subunit H2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014551 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014551 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014551 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025795 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025795 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025795 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014551 Rosetta Predictions human pricing
NM_152299 Rosetta Predictions human pricing
NM_001024877 Rosetta Predictions rat pricing
XM_001055014 Rosetta Predictions rat pricing
NM_001115132 Rosetta Predictions mouse pricing
NM_025795 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014551 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036826 predicted 640
2 SASI_Hs01_00036828 predicted 496
3 SASI_Hs02_00345813 predicted 258
4 SASI_Hs01_00036829 predicted 608
5 SASI_Hs01_00036830 predicted 467
6 SASI_Hs01_00036832 predicted 268
7 SASI_Hs01_00036833 predicted 333
8 SASI_Hs01_00036834 predicted 350
9 SASI_Hs01_00036835 predicted 282
10 SASI_Hs02_00345814 predicted 500
11 SASI_Hs01_00036827 predicted 306
12 SASI_Hs01_00036831 predicted 438
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152299 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096274 predicted 642
2 SASI_Hs01_00096276 predicted 503
3 SASI_Hs02_00365866 predicted 255
4 SASI_Hs01_00096277 predicted 610
5 SASI_Hs01_00096278 predicted 463
6 SASI_Hs01_00096280 predicted 277
7 SASI_Hs01_00096281 predicted 329
8 SASI_Hs01_00096282 predicted 345
9 SASI_Hs01_00096283 predicted 288
10 SASI_Hs02_00365867 predicted 502
11 SASI_Hs01_00096275 predicted 293
12 SASI_Hs01_00096279 predicted 417
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024877 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086375 predicted 1512
2 SASI_Rn01_00086376 predicted 438
3 SASI_Rn01_00086377 predicted 1052
4 SASI_Rn01_00086378 predicted 1442
5 SASI_Rn01_00086379 predicted 1257
6 SASI_Rn01_00086380 predicted 366
7 SASI_Rn01_00086381 predicted 1517
8 SASI_Rn01_00086382 predicted 405
9 SASI_Rn01_00086383 predicted 957
10 SASI_Rn01_00086384 predicted 975
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055014 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00278102 predicted 1056
2 SASI_Rn02_00278103 predicted 350
3 SASI_Rn02_00278104 predicted 1939
4 SASI_Rn02_00278105 predicted 1774
5 SASI_Rn02_00278106 predicted 1969
6 SASI_Rn02_00278107 predicted 1879
7 SASI_Rn02_00278108 predicted 1920
8 SASI_Rn02_00278109 predicted 1928
9 SASI_Rn02_00278110 predicted 782
10 SASI_Rn02_00278111 predicted 1921
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001115132 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308967 predicted 1249
2 SASI_Mm02_00308968 predicted 1559
3 SASI_Mm02_00308969 predicted 1067
4 SASI_Mm02_00308970 predicted 2062
5 SASI_Mm02_00308971 predicted 1527
6 SASI_Mm02_00308972 predicted 760
7 SASI_Mm02_00308973 predicted 677
8 SASI_Mm02_00308974 predicted 1853
9 SASI_Mm02_00308975 predicted 960
10 SASI_Mm02_00308976 predicted 960
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025795 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074460 predicted 1227
2 SASI_Mm02_00329039 predicted 1549
3 SASI_Mm01_00074461 predicted 1050
4 SASI_Mm02_00329040 predicted 2051
5 SASI_Mm01_00074463 predicted 1512
6 SASI_Mm01_00074464 predicted 747
7 SASI_Mm01_00074465 predicted 666
8 SASI_Mm01_00074469 predicted 1832
9 SASI_Mm02_00329041 predicted 949
10 SASI_Mm02_00329042 predicted 943
11 SASI_Mm01_00074462 predicted 202
12 SASI_Mm01_00074466 predicted 255
13 SASI_Mm01_00074467 predicted 535
14 SASI_Mm01_00074468 predicted 322
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014551
VALIDATED
NCAPH2 MISSION shRNA Bacterial Glycerol Stock
non-SMC condensin II complex, subunit H2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014551.4-1058s21c1
Sequence:CCGGCACAAGGAGGACAGTGGTATGCTCGAGCATACCACTGTCCTCCTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014551.4-353s21c1
Sequence:CCGGCGTCTACCAGGCCCTTGATTTCTCGAGAAATCAAGGGCCTGGTAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014551.4-321s21c1
Sequence:CCGGTACAGTAAGAAGGTGGAATACCTCGAGGTATTCCACCTTCTTACTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014551.4-508s21c1
Sequence:CCGGCTAACGTGGATCTCAAGAATGCTCGAGCATTCTTGAGATCCACGTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014551.4-255s21c1
Sequence:CCGGGACGAAGGCAAGACCACAATGCTCGAGCATTGTGGTCTTGCCTTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014551.3-564s1c1
Sequence:CCGGGAAATGGAGAAGAACAACAATCTCGAGATTGTTGTTCTTCTCCATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014551.3-296s1c1
Sequence:CCGGCAGTAAGAAGGTGGAATACCTCTCGAGAGGTATTCCACCTTCTTACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014551
VALIDATED
NCAPH2 MISSION shRNA shRNA Plasmid DNA
non-SMC condensin II complex, subunit H2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014551.4-1058s21c1
Sequence:CCGGCACAAGGAGGACAGTGGTATGCTCGAGCATACCACTGTCCTCCTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014551.4-353s21c1
Sequence:CCGGCGTCTACCAGGCCCTTGATTTCTCGAGAAATCAAGGGCCTGGTAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014551.4-321s21c1
Sequence:CCGGTACAGTAAGAAGGTGGAATACCTCGAGGTATTCCACCTTCTTACTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014551.4-508s21c1
Sequence:CCGGCTAACGTGGATCTCAAGAATGCTCGAGCATTCTTGAGATCCACGTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014551.4-255s21c1
Sequence:CCGGGACGAAGGCAAGACCACAATGCTCGAGCATTGTGGTCTTGCCTTCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014551.3-564s1c1
Sequence:CCGGGAAATGGAGAAGAACAACAATCTCGAGATTGTTGTTCTTCTCCATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014551.3-296s1c1
Sequence:CCGGCAGTAAGAAGGTGGAATACCTCTCGAGAGGTATTCCACCTTCTTACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014551
VALIDATED
NCAPH2 MISSION shRNA Lentiviral Transduction Particles
non-SMC condensin II complex, subunit H2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014551.4-1058s21c1
Sequence:CCGGCACAAGGAGGACAGTGGTATGCTCGAGCATACCACTGTCCTCCTTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014551.4-353s21c1
Sequence:CCGGCGTCTACCAGGCCCTTGATTTCTCGAGAAATCAAGGGCCTGGTAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014551.4-321s21c1
Sequence:CCGGTACAGTAAGAAGGTGGAATACCTCGAGGTATTCCACCTTCTTACTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014551.4-508s21c1
Sequence:CCGGCTAACGTGGATCTCAAGAATGCTCGAGCATTCTTGAGATCCACGTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014551.4-255s21c1
Sequence:CCGGGACGAAGGCAAGACCACAATGCTCGAGCATTGTGGTCTTGCCTTCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014551.3-564s1c1
Sequence:CCGGGAAATGGAGAAGAACAACAATCTCGAGATTGTTGTTCTTCTCCATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014551.3-296s1c1
Sequence:CCGGCAGTAAGAAGGTGGAATACCTCTCGAGAGGTATTCCACCTTCTTACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025795
VALIDATED
NCAPH2 MISSION shRNA Bacterial Glycerol Stock
non-SMC condensin II complex, subunit H2
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025795.2-1645s1c1
Sequence:CCGGCTCAATGAATGGTGTCCCTTTCTCGAGAAAGGGACACCATTCATTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025795.2-1197s1c1
Sequence:CCGGCCTGTACTGGAAACATGTGAACTCGAGTTCACATGTTTCCAGTACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025795.2-2051s1c1
Sequence:CCGGGCACAGATTAAGTACATCCATCTCGAGATGGATGTACTTAATCTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025795.2-1584s1c1
Sequence:CCGGGCAGCATGTGCCCTTTGATATCTCGAGATATCAAAGGGCACATGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025795.2-1250s1c1
Sequence:CCGGGACGTAAGATCAACGAGAGATCTCGAGATCTCTCGTTGATCTTACGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025795.2-2175s1c1
Sequence:CCGGGCGACCATAGTAATCGGTGAACTCGAGTTCACCGATTACTATGGTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025795
VALIDATED
NCAPH2 MISSION shRNA shRNA Plasmid DNA
non-SMC condensin II complex, subunit H2
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025795.2-1645s1c1
Sequence:CCGGCTCAATGAATGGTGTCCCTTTCTCGAGAAAGGGACACCATTCATTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025795.2-1197s1c1
Sequence:CCGGCCTGTACTGGAAACATGTGAACTCGAGTTCACATGTTTCCAGTACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025795.2-2051s1c1
Sequence:CCGGGCACAGATTAAGTACATCCATCTCGAGATGGATGTACTTAATCTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025795.2-1584s1c1
Sequence:CCGGGCAGCATGTGCCCTTTGATATCTCGAGATATCAAAGGGCACATGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025795.2-1250s1c1
Sequence:CCGGGACGTAAGATCAACGAGAGATCTCGAGATCTCTCGTTGATCTTACGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025795.2-2175s1c1
Sequence:CCGGGCGACCATAGTAATCGGTGAACTCGAGTTCACCGATTACTATGGTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025795
VALIDATED
NCAPH2 MISSION shRNA Lentiviral Transduction Particles
non-SMC condensin II complex, subunit H2
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025795.2-1645s1c1
Sequence:CCGGCTCAATGAATGGTGTCCCTTTCTCGAGAAAGGGACACCATTCATTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025795.2-1197s1c1
Sequence:CCGGCCTGTACTGGAAACATGTGAACTCGAGTTCACATGTTTCCAGTACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025795.2-2051s1c1
Sequence:CCGGGCACAGATTAAGTACATCCATCTCGAGATGGATGTACTTAATCTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025795.2-1584s1c1
Sequence:CCGGGCAGCATGTGCCCTTTGATATCTCGAGATATCAAAGGGCACATGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025795.2-1250s1c1
Sequence:CCGGGACGTAAGATCAACGAGAGATCTCGAGATCTCTCGTTGATCTTACGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025795.2-2175s1c1
Sequence:CCGGGCGACCATAGTAATCGGTGAACTCGAGTTCACCGATTACTATGGTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)