EMAIL THIS PAGE TO A FRIEND

NCAPH

non-SMC condensin I complex, subunit H

65 Gene Product Result for
Synonyms: BRRN1 CAP-H
UniProtKB ID: Q15003, Q8TB87
Gene ID:
Human(23397) Summary: This gene encodes a member of the barr gene family and a regulatory subunit of the condensin complex. This complex is required for the conversion of interphase chromatin into condensed chromosomes. The protein encoded by this gene is associated with mitotic chromosomes, except during the early phase of chromosome condensation. During interphase, the protein has a distinct punctate nucleolar localization. [provided by RefSeq, Jul 2008]
Mouse(215387) non-SMC condensin I complex, subunit H
Rat(680089) non-SMC condensin I complex, subunit H
sheep(101112636) non-SMC condensin I complex, subunit H
naked mole-rat(101705499) non-SMC condensin I complex, subunit H
Domestic Rabbit(100351730) non-SMC condensin I complex, subunit H
domestic guinea pig(100715422) non-SMC condensin I complex, subunit H
Zebrafish(570062) non-SMC condensin I complex, subunit H
cow(504477) non-SMC condensin I complex, subunit H
Horse(100062353) non-SMC condensin I complex, subunit H
dog(475741) non-SMC condensin I complex, subunit H
domestic cat(101092843) non-SMC condensin I complex, subunit H
chicken(425304) condensin complex subunit 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015341 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015341 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015341 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144818 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144818 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144818 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015341 Rosetta Predictions human pricing
XM_001055639 Rosetta Predictions rat pricing
NM_144818 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015341 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090559 predicted 1413
2 SASI_Hs01_00090560 predicted 1906
3 SASI_Hs01_00090561 predicted 731
4 SASI_Hs01_00090562 predicted 961
5 SASI_Hs02_00347647 predicted 1095
6 SASI_Hs01_00090563 predicted 405
7 SASI_Hs01_00090564 predicted 1510
8 SASI_Hs01_00090565 predicted 736
9 SASI_Hs01_00090566 predicted 494
10 SASI_Hs01_00090567 predicted 1605
11 SASI_Hs01_00090568 predicted 675
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055639 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00280429 predicted 1291
2 SASI_Rn02_00280430 predicted 427
3 SASI_Rn02_00280431 predicted 1913
4 SASI_Rn02_00280432 predicted 1419
5 SASI_Rn02_00280433 predicted 1629
6 SASI_Rn02_00280434 predicted 1742
7 SASI_Rn02_00280435 predicted 956
8 SASI_Rn02_00280436 predicted 633
9 SASI_Rn02_00280437 predicted 402
10 SASI_Rn02_00280438 predicted 1754
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144818 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340177 predicted 359
2 SASI_Mm02_00340178 predicted 233
3 SASI_Mm02_00340179 predicted 1839
4 SASI_Mm02_00340180 predicted 603
5 SASI_Mm02_00340181 predicted 1599
6 SASI_Mm02_00340182 predicted 249
7 SASI_Mm02_00340183 predicted 334
8 SASI_Mm02_00340184 predicted 301
9 SASI_Mm02_00340185 predicted 2059
10 SASI_Mm02_00340186 predicted 386
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015341
NCAPH MISSION shRNA Bacterial Glycerol Stock
non-SMC condensin I complex, subunit H
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000416499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015341.3-319s21c1
Sequence:CCGGACTGACTCACCTCGCTTATTGCTCGAGCAATAAGCGAGGTGAGTCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015341.2-388s1c1
Sequence:CCGGACACGCAGATTACGGAACATTCTCGAGAATGTTCCGTAATCTGCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015341.2-1900s1c1
Sequence:CCGGCCCAAGGATTAGACATCACAACTCGAGTTGTGATGTCTAATCCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015341.3-519s21c1
Sequence:CCGGCACCGAACCAACCAACTTTAACTCGAGTTAAAGTTGGTTGGTTCGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015341.2-106s1c1
Sequence:CCGGCCACAATGAATAACTCTTCTTCTCGAGAAGAAGAGTTATTCATTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015341.2-636s1c1
Sequence:CCGGGCACCGTCTTTGGAAGAAGTACTCGAGTACTTCTTCCAAAGACGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118057    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015341.2-2426s1c1
Sequence:CCGGCCTGTTTGTTTGTTGCTCTTTCTCGAGAAAGAGCAACAAACAAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015341
NCAPH MISSION shRNA shRNA Plasmid DNA
non-SMC condensin I complex, subunit H
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000416499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015341.3-319s21c1
Sequence:CCGGACTGACTCACCTCGCTTATTGCTCGAGCAATAAGCGAGGTGAGTCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015341.2-388s1c1
Sequence:CCGGACACGCAGATTACGGAACATTCTCGAGAATGTTCCGTAATCTGCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015341.2-1900s1c1
Sequence:CCGGCCCAAGGATTAGACATCACAACTCGAGTTGTGATGTCTAATCCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015341.3-519s21c1
Sequence:CCGGCACCGAACCAACCAACTTTAACTCGAGTTAAAGTTGGTTGGTTCGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015341.2-106s1c1
Sequence:CCGGCCACAATGAATAACTCTTCTTCTCGAGAAGAAGAGTTATTCATTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015341.2-636s1c1
Sequence:CCGGGCACCGTCTTTGGAAGAAGTACTCGAGTACTTCTTCCAAAGACGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118057    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015341.2-2426s1c1
Sequence:CCGGCCTGTTTGTTTGTTGCTCTTTCTCGAGAAAGAGCAACAAACAAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015341
NCAPH MISSION shRNA Lentiviral Transduction Particles
non-SMC condensin I complex, subunit H
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000416499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015341.3-319s21c1
Sequence:CCGGACTGACTCACCTCGCTTATTGCTCGAGCAATAAGCGAGGTGAGTCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015341.2-388s1c1
Sequence:CCGGACACGCAGATTACGGAACATTCTCGAGAATGTTCCGTAATCTGCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015341.2-1900s1c1
Sequence:CCGGCCCAAGGATTAGACATCACAACTCGAGTTGTGATGTCTAATCCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015341.3-519s21c1
Sequence:CCGGCACCGAACCAACCAACTTTAACTCGAGTTAAAGTTGGTTGGTTCGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015341.2-106s1c1
Sequence:CCGGCCACAATGAATAACTCTTCTTCTCGAGAAGAAGAGTTATTCATTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015341.2-636s1c1
Sequence:CCGGGCACCGTCTTTGGAAGAAGTACTCGAGTACTTCTTCCAAAGACGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118057    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015341.2-2426s1c1
Sequence:CCGGCCTGTTTGTTTGTTGCTCTTTCTCGAGAAAGAGCAACAAACAAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144818
VALIDATED
NCAPH MISSION shRNA Bacterial Glycerol Stock
non-SMC condensin I complex, subunit H
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144818.2-1679s21c1
Sequence:CCGGCTAACGACACCTCCAACTATTCTCGAGAATAGTTGGAGGTGTCGTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144818.2-1730s21c1
Sequence:CCGGATGAAGAGGCAGACGATTTATCTCGAGATAAATCGTCTGCCTCTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144818.2-308s21c1
Sequence:CCGGCAACTACCATATCTAAGTTTACTCGAGTAAACTTAGATATGGTAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144818.1-1566s1c1
Sequence:CCGGCCACAGATTTCCACTATGAAACTCGAGTTTCATAGTGGAAATCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144818.1-648s1c1
Sequence:CCGGCCCTTGAAACAGAAAGGACTACTCGAGTAGTCCTTTCTGTTTCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126859    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144818.1-2451s1c1
Sequence:CCGGGTACAGACAGTCCGATCTTTACTCGAGTAAAGATCGGACTGTCTGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144818.1-1434s1c1
Sequence:CCGGGTGCAAAGAAAGACTTTGAAACTCGAGTTTCAAAGTCTTTCTTTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144818.1-433s1c1
Sequence:CCGGCGGCTTGCATTTGATTGATTTCTCGAGAAATCAATCAAATGCAAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144818
VALIDATED
NCAPH MISSION shRNA shRNA Plasmid DNA
non-SMC condensin I complex, subunit H
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144818.2-1679s21c1
Sequence:CCGGCTAACGACACCTCCAACTATTCTCGAGAATAGTTGGAGGTGTCGTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144818.2-1730s21c1
Sequence:CCGGATGAAGAGGCAGACGATTTATCTCGAGATAAATCGTCTGCCTCTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144818.2-308s21c1
Sequence:CCGGCAACTACCATATCTAAGTTTACTCGAGTAAACTTAGATATGGTAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144818.1-1566s1c1
Sequence:CCGGCCACAGATTTCCACTATGAAACTCGAGTTTCATAGTGGAAATCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144818.1-648s1c1
Sequence:CCGGCCCTTGAAACAGAAAGGACTACTCGAGTAGTCCTTTCTGTTTCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126859    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144818.1-2451s1c1
Sequence:CCGGGTACAGACAGTCCGATCTTTACTCGAGTAAAGATCGGACTGTCTGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144818.1-1434s1c1
Sequence:CCGGGTGCAAAGAAAGACTTTGAAACTCGAGTTTCAAAGTCTTTCTTTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144818.1-433s1c1
Sequence:CCGGCGGCTTGCATTTGATTGATTTCTCGAGAAATCAATCAAATGCAAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144818
VALIDATED
NCAPH MISSION shRNA Lentiviral Transduction Particles
non-SMC condensin I complex, subunit H
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144818.2-1679s21c1
Sequence:CCGGCTAACGACACCTCCAACTATTCTCGAGAATAGTTGGAGGTGTCGTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144818.2-1730s21c1
Sequence:CCGGATGAAGAGGCAGACGATTTATCTCGAGATAAATCGTCTGCCTCTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144818.2-308s21c1
Sequence:CCGGCAACTACCATATCTAAGTTTACTCGAGTAAACTTAGATATGGTAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144818.1-1566s1c1
Sequence:CCGGCCACAGATTTCCACTATGAAACTCGAGTTTCATAGTGGAAATCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144818.1-648s1c1
Sequence:CCGGCCCTTGAAACAGAAAGGACTACTCGAGTAGTCCTTTCTGTTTCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126859    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144818.1-2451s1c1
Sequence:CCGGGTACAGACAGTCCGATCTTTACTCGAGTAAAGATCGGACTGTCTGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144818.1-1434s1c1
Sequence:CCGGGTGCAAAGAAAGACTTTGAAACTCGAGTTTCAAAGTCTTTCTTTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144818.1-433s1c1
Sequence:CCGGCGGCTTGCATTTGATTGATTTCTCGAGAAATCAATCAAATGCAAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)