EMAIL THIS PAGE TO A FRIEND

NCBP2

nuclear cap binding protein subunit 2, 20kDa

74 Gene Product Result for
Synonyms: CBC2 CBP20 NIP1
UniProtKB ID: P52298, B2RE91, B4DMK7, Q14924, Q2TS50
Gene ID:
Human(22916) Summary: The product of this gene is a component of the nuclear cap-binding protein complex (CBC), which binds to the monomethylated 5' cap of nascent pre-mRNA in the nucleoplasm. The encoded protein has an RNP domain commonly found in RNA binding proteins, and contains the cap-binding activity. The CBC promotes pre-mRNA splicing, 3'-end processing, RNA nuclear export, and nonsense-mediated mRNA decay. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(68092) nuclear cap binding protein subunit 2
Rat(288040) nuclear cap binding protein subunit 2
domestic guinea pig(100712590) nuclear cap binding protein subunit 2, 20kDa
naked mole-rat(101713846) nuclear cap binding protein subunit 2, 20kDa
sheep(101102358) nuclear cap binding protein subunit 2, 20kDa
Zebrafish(192325) nuclear cap binding protein subunit 2
chicken(424889) nuclear cap binding protein subunit 2, 20kDa
cow(510872) nuclear cap binding protein subunit 2, 20kDa
Horse(100060150) nuclear cap binding protein subunit 2, 20kDa
domestic cat(101083615) nuclear cap binding protein subunit 2, 20kDa
dog(478603) nuclear cap binding protein subunit 2, 20kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007362 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007362 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007362 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026554 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026554 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026554 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042540 Rosetta Predictions human pricing
NM_007362 Rosetta Predictions human pricing
XM_213591 Rosetta Predictions rat pricing
NM_026554 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042540 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310458 predicted 560
2 SASI_Hs02_00310459 predicted 498
3 SASI_Hs02_00310460 predicted 575
4 SASI_Hs02_00310461 predicted 799
5 SASI_Hs02_00310462 predicted 624
6 SASI_Hs02_00310463 predicted 739
7 SASI_Hs02_00310464 predicted 265
8 SASI_Hs02_00310465 predicted 753
9 SASI_Hs02_00310466 predicted 403
10 SASI_Hs02_00310467 predicted 423
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007362 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181632 predicted 717
2 SASI_Hs01_00181634 predicted 653
3 SASI_Hs01_00181635 predicted 731
4 SASI_Hs02_00343470 predicted 169
5 SASI_Hs02_00343471 predicted 206
6 SASI_Hs02_00343472 predicted 205
7 SASI_Hs02_00343473 predicted 287
8 SASI_Hs02_00343474 predicted 845
9 SASI_Hs02_00343475 predicted 830
10 SASI_Hs02_00343476 predicted 254
11 SASI_Hs01_00181633 predicted 536
12 SASI_Hs01_00181636 predicted 367
13 SASI_Hs01_00181637 predicted 677
14 SASI_Hs01_00181638 predicted 425
15 SASI_Hs01_00181639 predicted 500
16 SASI_Hs01_00181640 predicted 526
17 SASI_Hs01_00181641 predicted 589
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213591 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00126821 predicted 293
2 SASI_Rn01_00126822 predicted 631
3 SASI_Rn01_00126823 predicted 631
4 SASI_Rn01_00126824 predicted 690
5 SASI_Rn01_00126825 predicted 934
6 SASI_Rn01_00126826 predicted 896
7 SASI_Rn01_00126827 predicted 355
8 SASI_Rn01_00126828 predicted 254
9 SASI_Rn01_00126829 predicted 540
10 SASI_Rn01_00126830 predicted 849
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026554 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330485 predicted 210
2 SASI_Mm01_00074933 predicted 444
3 SASI_Mm01_00074934 predicted 290
4 SASI_Mm01_00074935 predicted 611
5 SASI_Mm01_00074936 predicted 542
6 SASI_Mm02_00330486 predicted 524
7 SASI_Mm01_00074937 predicted 498
8 SASI_Mm01_00074938 predicted 499
9 SASI_Mm01_00074939 predicted 334
10 SASI_Mm02_00330487 predicted 343
11 SASI_Mm01_00074932 predicted 702
12 SASI_Mm01_00074940 predicted 455
13 SASI_Mm01_00074941 predicted 514
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007362
VALIDATED
NCBP2 MISSION shRNA Bacterial Glycerol Stock
nuclear cap binding protein subunit 2, 20kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007362.2-192s1c1
Sequence:CCGGATCTATGAACTCTTCAGCAAACTCGAGTTTGCTGAAGAGTTCATAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007362.3-429s21c1
Sequence:CCGGAGACTGGGACGCAGGCTTTAACTCGAGTTAAAGCCTGCGTCCCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_007362.2-106s1c1
Sequence:CCGGGTGACAATGAAGAACAAGAAACTCGAGTTTCTTGTTCTTCATTGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007362.2-285s1c1
Sequence:CCGGGAATATTACTCACGCGCAGATCTCGAGATCTGCGCGTGAGTAATATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_007362.2-142s1c1
Sequence:CCGGGCTGTACGTTATATGTTGGAACTCGAGTTCCAACATATAACGTACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007362.2-339s1c1
Sequence:CCGGCGTCTGGATGACCGAATCATTCTCGAGAATGATTCGGTCATCCAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007362.3-170s21c1
Sequence:CCGGGTGACAATGAAGAACAAGAAACTCGAGTTTCTTGTTCTTCATTGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303608    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_007362.3-966s21c1
Sequence:CCGGTTGCATGAGATAGCCTAATAACTCGAGTTATTAGGCTATCTCATGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_007362.3-295s21c1
Sequence:CCGGATCATTATGGGTCTGGATAAACTCGAGTTTATCCAGACCCATAATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007362.3-377s21c1
Sequence:CCGGACGCCATGCGGTACATAAATGCTCGAGCATTTATGTACCGCATGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007362
VALIDATED
NCBP2 MISSION shRNA shRNA Plasmid DNA
nuclear cap binding protein subunit 2, 20kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007362.2-192s1c1
Sequence:CCGGATCTATGAACTCTTCAGCAAACTCGAGTTTGCTGAAGAGTTCATAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007362.3-429s21c1
Sequence:CCGGAGACTGGGACGCAGGCTTTAACTCGAGTTAAAGCCTGCGTCCCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_007362.2-106s1c1
Sequence:CCGGGTGACAATGAAGAACAAGAAACTCGAGTTTCTTGTTCTTCATTGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007362.2-285s1c1
Sequence:CCGGGAATATTACTCACGCGCAGATCTCGAGATCTGCGCGTGAGTAATATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_007362.2-142s1c1
Sequence:CCGGGCTGTACGTTATATGTTGGAACTCGAGTTCCAACATATAACGTACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007362.2-339s1c1
Sequence:CCGGCGTCTGGATGACCGAATCATTCTCGAGAATGATTCGGTCATCCAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007362.3-170s21c1
Sequence:CCGGGTGACAATGAAGAACAAGAAACTCGAGTTTCTTGTTCTTCATTGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303608    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_007362.3-966s21c1
Sequence:CCGGTTGCATGAGATAGCCTAATAACTCGAGTTATTAGGCTATCTCATGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_007362.3-295s21c1
Sequence:CCGGATCATTATGGGTCTGGATAAACTCGAGTTTATCCAGACCCATAATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007362.3-377s21c1
Sequence:CCGGACGCCATGCGGTACATAAATGCTCGAGCATTTATGTACCGCATGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007362
VALIDATED
NCBP2 MISSION shRNA Lentiviral Transduction Particles
nuclear cap binding protein subunit 2, 20kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007362.2-192s1c1
Sequence:CCGGATCTATGAACTCTTCAGCAAACTCGAGTTTGCTGAAGAGTTCATAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007362.3-429s21c1
Sequence:CCGGAGACTGGGACGCAGGCTTTAACTCGAGTTAAAGCCTGCGTCCCAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_007362.2-106s1c1
Sequence:CCGGGTGACAATGAAGAACAAGAAACTCGAGTTTCTTGTTCTTCATTGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007362.2-285s1c1
Sequence:CCGGGAATATTACTCACGCGCAGATCTCGAGATCTGCGCGTGAGTAATATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_007362.2-142s1c1
Sequence:CCGGGCTGTACGTTATATGTTGGAACTCGAGTTCCAACATATAACGTACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007362.2-339s1c1
Sequence:CCGGCGTCTGGATGACCGAATCATTCTCGAGAATGATTCGGTCATCCAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007362.3-170s21c1
Sequence:CCGGGTGACAATGAAGAACAAGAAACTCGAGTTTCTTGTTCTTCATTGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303608    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_007362.3-966s21c1
Sequence:CCGGTTGCATGAGATAGCCTAATAACTCGAGTTATTAGGCTATCTCATGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_007362.3-295s21c1
Sequence:CCGGATCATTATGGGTCTGGATAAACTCGAGTTTATCCAGACCCATAATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007362.3-377s21c1
Sequence:CCGGACGCCATGCGGTACATAAATGCTCGAGCATTTATGTACCGCATGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026554
VALIDATED
NCBP2 MISSION shRNA Bacterial Glycerol Stock
nuclear cap binding protein subunit 2, 20kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102315    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026554.2-632s1c1
Sequence:CCGGCGCCTTTAACTCTAGTCTTATCTCGAGATAAGACTAGAGTTAAAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026554.2-129s1c1
Sequence:CCGGCTGTACGTTGTATGTTGGAAACTCGAGTTTCCAACATACAACGTACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026554.2-307s1c1
Sequence:CCGGCGGTACATAAACGGAACTCGTCTCGAGACGAGTTCCGTTTATGTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026554.2-455s1c1
Sequence:CCGGGCTATGGGAAACTGGCACAAACTCGAGTTTGTGCCAGTTTCCCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026554.4-388s21c1
Sequence:CCGGAGAACGCAATGCGGTACATAACTCGAGTTATGTACCGCATTGCGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026554.4-399s21c1
Sequence:CCGGCGGTACATAAACGGAACTCGTCTCGAGACGAGTTCCGTTTATGTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026554.2-296s1c1
Sequence:CCGGAGAACGCAATGCGGTACATAACTCGAGTTATGTACCGCATTGCGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026554.4-547s21c1
Sequence:CCGGGCTATGGGAAACTGGCACAAACTCGAGTTTGTGCCAGTTTCCCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026554.4-221s21c1
Sequence:CCGGCTGTACGTTGTATGTTGGAAACTCGAGTTTCCAACATACAACGTACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026554
VALIDATED
NCBP2 MISSION shRNA shRNA Plasmid DNA
nuclear cap binding protein subunit 2, 20kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102315    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026554.2-632s1c1
Sequence:CCGGCGCCTTTAACTCTAGTCTTATCTCGAGATAAGACTAGAGTTAAAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026554.2-129s1c1
Sequence:CCGGCTGTACGTTGTATGTTGGAAACTCGAGTTTCCAACATACAACGTACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026554.2-307s1c1
Sequence:CCGGCGGTACATAAACGGAACTCGTCTCGAGACGAGTTCCGTTTATGTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026554.2-455s1c1
Sequence:CCGGGCTATGGGAAACTGGCACAAACTCGAGTTTGTGCCAGTTTCCCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000354086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026554.4-388s21c1
Sequence:CCGGAGAACGCAATGCGGTACATAACTCGAGTTATGTACCGCATTGCGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000354006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026554.4-399s21c1
Sequence:CCGGCGGTACATAAACGGAACTCGTCTCGAGACGAGTTCCGTTTATGTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026554.2-296s1c1
Sequence:CCGGAGAACGCAATGCGGTACATAACTCGAGTTATGTACCGCATTGCGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000354084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026554.4-547s21c1
Sequence:CCGGGCTATGGGAAACTGGCACAAACTCGAGTTTGTGCCAGTTTCCCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026554.4-221s21c1
Sequence:CCGGCTGTACGTTGTATGTTGGAAACTCGAGTTTCCAACATACAACGTACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026554
VALIDATED
NCBP2 MISSION shRNA Lentiviral Transduction Particles
nuclear cap binding protein subunit 2, 20kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102315    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026554.2-632s1c1
Sequence:CCGGCGCCTTTAACTCTAGTCTTATCTCGAGATAAGACTAGAGTTAAAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026554.2-129s1c1
Sequence:CCGGCTGTACGTTGTATGTTGGAAACTCGAGTTTCCAACATACAACGTACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026554.2-307s1c1
Sequence:CCGGCGGTACATAAACGGAACTCGTCTCGAGACGAGTTCCGTTTATGTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026554.2-455s1c1
Sequence:CCGGGCTATGGGAAACTGGCACAAACTCGAGTTTGTGCCAGTTTCCCATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026554.4-388s21c1
Sequence:CCGGAGAACGCAATGCGGTACATAACTCGAGTTATGTACCGCATTGCGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026554.4-399s21c1
Sequence:CCGGCGGTACATAAACGGAACTCGTCTCGAGACGAGTTCCGTTTATGTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026554.2-296s1c1
Sequence:CCGGAGAACGCAATGCGGTACATAACTCGAGTTATGTACCGCATTGCGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026554.4-547s21c1
Sequence:CCGGGCTATGGGAAACTGGCACAAACTCGAGTTTGTGCCAGTTTCCCATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026554.4-221s21c1
Sequence:CCGGCTGTACGTTGTATGTTGGAAACTCGAGTTTCCAACATACAACGTACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)