EMAIL THIS PAGE TO A FRIEND

NCCRP1

non-specific cytotoxic cell receptor protein 1 homolog (zebrafish)

60 Gene Product Result for
Synonyms: FBXO50 NCCRP-1
UniProtKB ID: Q6ZVX7, Q6NVV5
Gene ID:
Mouse(233038) non-specific cytotoxic cell receptor protein 1 homolog (zebrafish)
Rat(292755) non-specific cytotoxic cell receptor protein 1 homolog (zebrafish)
Zebrafish(30078) nonspecific cytotoxic cell receptor protein 1
dog(612546) non-specific cytotoxic cell receptor protein 1 homolog (zebrafish)
cow(519042) non-specific cytotoxic cell receptor protein 1 homolog (zebrafish)
domestic cat(101092221) non-specific cytotoxic cell receptor protein 1 homolog (zebrafish)
sheep(101115397) non-specific cytotoxic cell receptor protein 1 homolog (zebrafish)
naked mole-rat(101721063) non-specific cytotoxic cell receptor protein 1 homolog (zebrafish)
domestic guinea pig(100731183) non-specific cytotoxic cell receptor protein 1 homolog (zebrafish)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081115 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081115 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081115 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001001414 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001414 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001414 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001414 Rosetta Predictions human pricing
NM_001134506 Rosetta Predictions rat pricing
NM_001081115 Rosetta Predictions mouse pricing
XM_133360 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001414 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013123 predicted 910
2 SASI_Hs02_00303746 predicted 538
3 SASI_Hs02_00303747 predicted 1153
4 SASI_Hs01_00013124 predicted 835
5 SASI_Hs02_00303748 predicted 544
6 SASI_Hs02_00303749 predicted 431
7 SASI_Hs01_00013127 predicted 590
8 SASI_Hs02_00303750 predicted 1084
9 SASI_Hs02_00303751 predicted 1050
10 SASI_Hs02_00303752 predicted 956
11 SASI_Hs01_00013122 predicted 712
12 SASI_Hs01_00013125 predicted 419
13 SASI_Hs01_00013126 predicted 583
14 SASI_Hs01_00013128 predicted 844
15 SASI_Hs01_00013129 predicted 554
16 SASI_Hs01_00013130 predicted 919
17 SASI_Hs01_00013131 predicted 728
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134506 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256549 predicted 602
2 SASI_Rn02_00256550 predicted 609
3 SASI_Rn02_00256551 predicted 733
4 SASI_Rn02_00256552 predicted 1220
5 SASI_Rn02_00256553 predicted 784
6 SASI_Rn02_00256554 predicted 769
7 SASI_Rn02_00256555 predicted 383
8 SASI_Rn02_00256556 predicted 1306
9 SASI_Rn02_00256557 predicted 666
10 SASI_Rn02_00256558 predicted 763
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081115 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295331 predicted 566
2 SASI_Mm02_00295332 predicted 693
3 SASI_Mm02_00295333 predicted 1013
4 SASI_Mm02_00295334 predicted 734
5 SASI_Mm02_00295335 predicted 606
6 SASI_Mm02_00295336 predicted 1031
7 SASI_Mm02_00295337 predicted 345
8 SASI_Mm02_00295338 predicted 571
9 SASI_Mm02_00295339 predicted 575
10 SASI_Mm02_00295340 predicted 1019
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_133360 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00262051 predicted 563
2 SASI_Mm01_00262052 predicted 690
3 SASI_Mm01_00262053 predicted 1023
4 SASI_Mm01_00262054 predicted 734
5 SASI_Mm01_00262055 predicted 1429
6 SASI_Mm01_00262056 predicted 738
7 SASI_Mm01_00262057 predicted 1166
8 SASI_Mm01_00262058 predicted 346
9 SASI_Mm01_00262059 predicted 571
10 SASI_Mm01_00262060 predicted 1022
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081115
NCCRP1 MISSION shRNA Bacterial Glycerol Stock
non-specific cytotoxic cell receptor protein 1 homolog (zebrafish)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081115.1-728s21c1
Sequence:CCGGCCGCCTAGACCAGTGTGTTTACTCGAGTAAACACACTGGTCTAGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081115.1-900s21c1
Sequence:CCGGTACTTCCAGCACAAGGCTAAGCTCGAGCTTAGCCTTGTGCTGGAAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081115.1-494s21c1
Sequence:CCGGCAACCCAGAAGGCATTAATATCTCGAGATATTAATGCCTTCTGGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081115.1-1019s21c1
Sequence:CCGGGCTAACGCGATCGATCCTTTGCTCGAGCAAAGGATCGATCGCGTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081115.1-554s21c1
Sequence:CCGGCCTGAAGGAGCTGGGTAATTTCTCGAGAAATTACCCAGCTCCTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081115
NCCRP1 MISSION shRNA shRNA Plasmid DNA
non-specific cytotoxic cell receptor protein 1 homolog (zebrafish)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081115.1-728s21c1
Sequence:CCGGCCGCCTAGACCAGTGTGTTTACTCGAGTAAACACACTGGTCTAGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081115.1-900s21c1
Sequence:CCGGTACTTCCAGCACAAGGCTAAGCTCGAGCTTAGCCTTGTGCTGGAAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081115.1-494s21c1
Sequence:CCGGCAACCCAGAAGGCATTAATATCTCGAGATATTAATGCCTTCTGGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081115.1-1019s21c1
Sequence:CCGGGCTAACGCGATCGATCCTTTGCTCGAGCAAAGGATCGATCGCGTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081115.1-554s21c1
Sequence:CCGGCCTGAAGGAGCTGGGTAATTTCTCGAGAAATTACCCAGCTCCTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081115
NCCRP1 MISSION shRNA Lentiviral Transduction Particles
non-specific cytotoxic cell receptor protein 1 homolog (zebrafish)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081115.1-728s21c1
Sequence:CCGGCCGCCTAGACCAGTGTGTTTACTCGAGTAAACACACTGGTCTAGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081115.1-900s21c1
Sequence:CCGGTACTTCCAGCACAAGGCTAAGCTCGAGCTTAGCCTTGTGCTGGAAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081115.1-494s21c1
Sequence:CCGGCAACCCAGAAGGCATTAATATCTCGAGATATTAATGCCTTCTGGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081115.1-1019s21c1
Sequence:CCGGGCTAACGCGATCGATCCTTTGCTCGAGCAAAGGATCGATCGCGTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081115.1-554s21c1
Sequence:CCGGCCTGAAGGAGCTGGGTAATTTCTCGAGAAATTACCCAGCTCCTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001414
NCCRP1 MISSION shRNA Bacterial Glycerol Stock
non-specific cytotoxic cell receptor protein 1 homolog (zebrafish)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001414.1-406s1c1
Sequence:CCGGCCTGGAAACTCTGGGCAATTTCTCGAGAAATTGCCCAGAGTTTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060503    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001414.1-1521s1c1
Sequence:CCGGCCTCTCAAGTAGCTGGGATTACTCGAGTAATCCCAGCTACTTGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001414.1-533s1c1
Sequence:CCGGGATGACGAACAACCAGCCATTCTCGAGAATGGCTGGTTGTTCGTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001414.1-432s1c1
Sequence:CCGGGCTGGTACATTAGAACTGAAACTCGAGTTTCAGTTCTAATGTACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001414.1-350s1c1
Sequence:CCGGCCCGAAGGCATCAACATTTATCTCGAGATAAATGTTGATGCCTTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001414
NCCRP1 MISSION shRNA shRNA Plasmid DNA
non-specific cytotoxic cell receptor protein 1 homolog (zebrafish)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001414.1-406s1c1
Sequence:CCGGCCTGGAAACTCTGGGCAATTTCTCGAGAAATTGCCCAGAGTTTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060503    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001414.1-1521s1c1
Sequence:CCGGCCTCTCAAGTAGCTGGGATTACTCGAGTAATCCCAGCTACTTGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001414.1-533s1c1
Sequence:CCGGGATGACGAACAACCAGCCATTCTCGAGAATGGCTGGTTGTTCGTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001414.1-432s1c1
Sequence:CCGGGCTGGTACATTAGAACTGAAACTCGAGTTTCAGTTCTAATGTACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001414.1-350s1c1
Sequence:CCGGCCCGAAGGCATCAACATTTATCTCGAGATAAATGTTGATGCCTTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001414
NCCRP1 MISSION shRNA Lentiviral Transduction Particles
non-specific cytotoxic cell receptor protein 1 homolog (zebrafish)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001414.1-406s1c1
Sequence:CCGGCCTGGAAACTCTGGGCAATTTCTCGAGAAATTGCCCAGAGTTTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060503    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001414.1-1521s1c1
Sequence:CCGGCCTCTCAAGTAGCTGGGATTACTCGAGTAATCCCAGCTACTTGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001414.1-533s1c1
Sequence:CCGGGATGACGAACAACCAGCCATTCTCGAGAATGGCTGGTTGTTCGTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001414.1-432s1c1
Sequence:CCGGGCTGGTACATTAGAACTGAAACTCGAGTTTCAGTTCTAATGTACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001414.1-350s1c1
Sequence:CCGGCCCGAAGGCATCAACATTTATCTCGAGATAAATGTTGATGCCTTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)