EMAIL THIS PAGE TO A FRIEND

NCDN

neurochondrin

155 Gene Product Result for
UniProtKB ID: Q9UBB6, D3DPR9, Q9UBY2, Q9Y4A6, Q9Y4D9
Gene ID:
Human(23154) Summary: This gene encodes a leucine-rich cytoplasmic protein, which is highly similar to a mouse protein that negatively regulates Ca/calmodulin-dependent protein kinase II phosphorylation and may be essential for spatial learning processes. Several alternatively spliced transcript variants of this gene have been described. [provided by RefSeq, Jul 2008]
Mouse(26562) neurochondrin
Rat(89791) neurochondrin
Zebrafish(571005) neurochondrin
chicken(419633) neurochondrin
cow(505994) neurochondrin
domestic cat(101086243) neurochondrin
dog(475339) neurochondrin
sheep(101115750) neurochondrin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011986 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011986 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011986 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014284 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014284 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014284 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001014839 Rosetta Predictions human pricing
NM_001014841 Rosetta Predictions human pricing
NM_014284 Rosetta Predictions human pricing
NM_053543 Rosetta Predictions rat pricing
NM_011986 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014839 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143757 predicted 1130
2 SASI_Hs01_00143758 predicted 1189
3 SASI_Hs01_00143760 predicted 1961
4 SASI_Hs01_00143761 predicted 1922
5 SASI_Hs01_00143762 predicted 817
6 SASI_Hs01_00143764 predicted 1581
7 SASI_Hs01_00143765 predicted 1340
8 SASI_Hs01_00143766 predicted 936
9 SASI_Hs02_00306588 predicted 1670
10 SASI_Hs02_00306589 predicted 1193
11 SASI_Hs01_00143759 predicted 2807
12 SASI_Hs01_00143763 predicted 2172
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014841 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118278 predicted 1056
2 SASI_Hs01_00118279 predicted 1114
3 SASI_Hs01_00118281 predicted 1895
4 SASI_Hs01_00118282 predicted 1847
5 SASI_Hs01_00118283 predicted 748
6 SASI_Hs01_00118284 predicted 1512
7 SASI_Hs01_00118285 predicted 1272
8 SASI_Hs01_00118286 predicted 871
9 SASI_Hs01_00118287 predicted 1602
10 SASI_Hs02_00306592 predicted 1134
11 SASI_Hs01_00118280 predicted 2749
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014284 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132829 predicted 1403
2 SASI_Hs01_00132830 predicted 1457
3 SASI_Hs01_00132832 predicted 2233
4 SASI_Hs01_00132833 predicted 2194
5 SASI_Hs01_00132834 predicted 1085
6 SASI_Hs01_00132835 predicted 1850
7 SASI_Hs01_00132836 predicted 1611
8 SASI_Hs01_00132837 predicted 1212
9 SASI_Hs01_00132838 predicted 1949
10 SASI_Hs02_00345368 predicted 1471
11 SASI_Hs01_00132831 predicted 3080
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053543 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064673 predicted 485
2 SASI_Rn01_00064674 predicted 1509
3 SASI_Rn01_00064675 predicted 868
4 SASI_Rn01_00064676 predicted 1059
5 SASI_Rn01_00064678 predicted 1044
6 SASI_Rn01_00064679 predicted 1333
7 SASI_Rn01_00064680 predicted 1622
8 SASI_Rn02_00266164 predicted 2498
9 SASI_Rn01_00064681 predicted 1909
10 SASI_Rn01_00064682 predicted 569
11 SASI_Rn01_00064677 predicted 1741
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011986 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321912 predicted 1504
2 SASI_Mm01_00195441 predicted 573
3 SASI_Mm01_00195443 predicted 1139
4 SASI_Mm01_00195445 predicted 1519
5 SASI_Mm01_00195446 predicted 834
6 SASI_Mm01_00195447 predicted 1705
7 SASI_Mm01_00195448 predicted 1993
8 SASI_Mm01_00195450 predicted 1614
9 SASI_Mm02_00321913 predicted 1012
10 SASI_Mm02_00321914 predicted 626
11 SASI_Mm01_00195442 predicted 1514
12 SASI_Mm01_00195444 predicted 1635
13 SASI_Mm01_00195449 predicted 2015
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011986
VALIDATED
NCDN MISSION shRNA Bacterial Glycerol Stock
neurochondrin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011986.2-1339s1c1
Sequence:CCGGGAGGTGAAAGAAGACGTGGTACTCGAGTACCACGTCTTCTTTCACCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011986.2-577s1c1
Sequence:CCGGCGTAGGATCTTTGATGCCGTTCTCGAGAACGGCATCAAAGATCCTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011986.2-1789s1c1
Sequence:CCGGCGGGAGATTCTGATCAAGGAACTCGAGTTCCTTGATCAGAATCTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011986.2-2367s1c1
Sequence:CCGGGCTAGGTAGTGTAAGCCCTAACTCGAGTTAGGGCTTACACTACCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119417    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011986.2-2694s1c1
Sequence:CCGGCCACCTCTCAAGTATAAGAAACTCGAGTTTCTTATACTTGAGAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011986
VALIDATED
NCDN MISSION shRNA shRNA Plasmid DNA
neurochondrin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011986.2-1339s1c1
Sequence:CCGGGAGGTGAAAGAAGACGTGGTACTCGAGTACCACGTCTTCTTTCACCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011986.2-577s1c1
Sequence:CCGGCGTAGGATCTTTGATGCCGTTCTCGAGAACGGCATCAAAGATCCTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011986.2-1789s1c1
Sequence:CCGGCGGGAGATTCTGATCAAGGAACTCGAGTTCCTTGATCAGAATCTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011986.2-2367s1c1
Sequence:CCGGGCTAGGTAGTGTAAGCCCTAACTCGAGTTAGGGCTTACACTACCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119417    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011986.2-2694s1c1
Sequence:CCGGCCACCTCTCAAGTATAAGAAACTCGAGTTTCTTATACTTGAGAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011986
VALIDATED
NCDN MISSION shRNA Lentiviral Transduction Particles
neurochondrin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011986.2-1339s1c1
Sequence:CCGGGAGGTGAAAGAAGACGTGGTACTCGAGTACCACGTCTTCTTTCACCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011986.2-577s1c1
Sequence:CCGGCGTAGGATCTTTGATGCCGTTCTCGAGAACGGCATCAAAGATCCTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011986.2-1789s1c1
Sequence:CCGGCGGGAGATTCTGATCAAGGAACTCGAGTTCCTTGATCAGAATCTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011986.2-2367s1c1
Sequence:CCGGGCTAGGTAGTGTAAGCCCTAACTCGAGTTAGGGCTTACACTACCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119417    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011986.2-2694s1c1
Sequence:CCGGCCACCTCTCAAGTATAAGAAACTCGAGTTTCTTATACTTGAGAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014284
NCDN MISSION shRNA Bacterial Glycerol Stock
neurochondrin
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014284.1-2169s1c1
Sequence:CCGGCCATCCTCTTCCTATCACAGTCTCGAGACTGTGATAGGAAGAGGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014284.1-1999s1c1
Sequence:CCGGCACATCTCTAATGAACACCCTCTCGAGAGGGTGTTCATTAGAGATGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014284.1-511s1c1
Sequence:CCGGCAAGAATGACAGCGAGCAGTTCTCGAGAACTGCTCGCTGTCATTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014284.1-760s1c1
Sequence:CCGGGATTCCCATTCTTAGCACCTTCTCGAGAAGGTGCTAAGAATGGGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153259    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014284.1-1055s1c1
Sequence:CCGGGATTTCCAGAAAGCTGAGGATCTCGAGATCCTCAGCTTTCTGGAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014284.1-749s1c1
Sequence:CCGGGTCCTGAACAAGATTCCCATTCTCGAGAATGGGAATCTTGTTCAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014284.1-566s1c1
Sequence:CCGGGCAGGTGACATAGATGCCAAACTCGAGTTTGGCATCTATGTCACCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014284.1-1843s1c1
Sequence:CCGGGTGCAAGTATTTCCTGCAGCACTCGAGTGCTGCAGGAAATACTTGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014284
NCDN MISSION shRNA shRNA Plasmid DNA
neurochondrin
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014284.1-2169s1c1
Sequence:CCGGCCATCCTCTTCCTATCACAGTCTCGAGACTGTGATAGGAAGAGGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014284.1-1999s1c1
Sequence:CCGGCACATCTCTAATGAACACCCTCTCGAGAGGGTGTTCATTAGAGATGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014284.1-511s1c1
Sequence:CCGGCAAGAATGACAGCGAGCAGTTCTCGAGAACTGCTCGCTGTCATTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014284.1-760s1c1
Sequence:CCGGGATTCCCATTCTTAGCACCTTCTCGAGAAGGTGCTAAGAATGGGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153259    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014284.1-1055s1c1
Sequence:CCGGGATTTCCAGAAAGCTGAGGATCTCGAGATCCTCAGCTTTCTGGAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014284.1-749s1c1
Sequence:CCGGGTCCTGAACAAGATTCCCATTCTCGAGAATGGGAATCTTGTTCAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014284.1-566s1c1
Sequence:CCGGGCAGGTGACATAGATGCCAAACTCGAGTTTGGCATCTATGTCACCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014284.1-1843s1c1
Sequence:CCGGGTGCAAGTATTTCCTGCAGCACTCGAGTGCTGCAGGAAATACTTGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014284
NCDN MISSION shRNA Lentiviral Transduction Particles
neurochondrin
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014284.1-2169s1c1
Sequence:CCGGCCATCCTCTTCCTATCACAGTCTCGAGACTGTGATAGGAAGAGGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014284.1-1999s1c1
Sequence:CCGGCACATCTCTAATGAACACCCTCTCGAGAGGGTGTTCATTAGAGATGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014284.1-511s1c1
Sequence:CCGGCAAGAATGACAGCGAGCAGTTCTCGAGAACTGCTCGCTGTCATTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014284.1-760s1c1
Sequence:CCGGGATTCCCATTCTTAGCACCTTCTCGAGAAGGTGCTAAGAATGGGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153259    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014284.1-1055s1c1
Sequence:CCGGGATTTCCAGAAAGCTGAGGATCTCGAGATCCTCAGCTTTCTGGAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014284.1-749s1c1
Sequence:CCGGGTCCTGAACAAGATTCCCATTCTCGAGAATGGGAATCTTGTTCAGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014284.1-566s1c1
Sequence:CCGGGCAGGTGACATAGATGCCAAACTCGAGTTTGGCATCTATGTCACCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014284.1-1843s1c1
Sequence:CCGGGTGCAAGTATTTCCTGCAGCACTCGAGTGCTGCAGGAAATACTTGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)