EMAIL THIS PAGE TO A FRIEND

NCEH1

neutral cholesterol ester hydrolase 1

139 Gene Product Result for
Synonyms: AADACL1 NCEH
Gene ID:
Mouse(320024) neutral cholesterol ester hydrolase 1
Rat(294930) neutral cholesterol ester hydrolase 1
chicken(429158) neutral cholesterol ester hydrolase 1
dog(488171) neutral cholesterol ester hydrolase 1
domestic cat(101082846) neutral cholesterol ester hydrolase 1
cow(534212) neutral cholesterol ester hydrolase 1
Horse(100064432) neutral cholesterol ester hydrolase 1
sheep(101113553) neutral cholesterol ester hydrolase 1
domestic guinea pig(100733399) neutral cholesterol ester hydrolase 1
naked mole-rat(101703160) neutral cholesterol ester hydrolase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA026888 Anti-NCEH1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4301148 Anti-NCEH1 antibody produced in rabbit affinity isolated antibody human, mouse
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020792 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020792 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020792 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178772 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178772 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178772 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020792 Rosetta Predictions human pricing
NM_001127524 Rosetta Predictions rat pricing
XM_227000 Rosetta Predictions rat pricing
XR_008069 Rosetta Predictions rat pricing
NM_178772 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020792 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079090 predicted 1024
2 SASI_Hs02_00353952 predicted 1033
3 SASI_Hs01_00079092 predicted 542
4 SASI_Hs01_00079093 predicted 1248
5 SASI_Hs01_00079094 predicted 1027
6 SASI_Hs01_00079095 predicted 1137
7 SASI_Hs01_00079096 predicted 773
8 SASI_Hs01_00079097 predicted 362
9 SASI_Hs01_00079098 predicted 1424
10 SASI_Hs01_00079099 predicted 896
11 SASI_Hs01_00079091 predicted 872
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127524 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253993 predicted 819
2 SASI_Rn02_00253994 predicted 718
3 SASI_Rn02_00253995 predicted 1358
4 SASI_Rn02_00253996 predicted 518
5 SASI_Rn02_00253997 predicted 621
6 SASI_Rn02_00253998 predicted 1134
7 SASI_Rn02_00253999 predicted 215
8 SASI_Rn02_00254000 predicted 814
9 SASI_Rn02_00254001 predicted 1236
10 SASI_Rn02_00254002 predicted 316
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227000 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00153982 predicted 514
2 SASI_Rn01_00153983 predicted 1154
3 SASI_Rn01_00153984 predicted 1054
4 SASI_Rn01_00153985 predicted 1268
5 SASI_Rn01_00153986 predicted 956
6 SASI_Rn01_00153987 predicted 1179
7 SASI_Rn01_00153988 predicted 546
8 SASI_Rn01_00153989 predicted 1174
9 SASI_Rn01_00153990 predicted 660
10 SASI_Rn01_00153991 predicted 1019
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008069 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00168488 predicted 237
2 SASI_Rn01_00168489 predicted 875
3 SASI_Rn01_00168490 predicted 2141
4 SASI_Rn01_00168491 predicted 2544
5 SASI_Rn01_00168492 predicted 2042
6 SASI_Rn01_00168493 predicted 2233
7 SASI_Rn01_00168494 predicted 2387
8 SASI_Rn01_00168495 predicted 2915
9 SASI_Rn01_00168496 predicted 1464
10 SASI_Rn01_00168497 predicted 1995
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178772 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168569 predicted 201
2 SASI_Mm01_00168570 predicted 1596
3 SASI_Mm01_00168571 predicted 764
4 SASI_Mm01_00168572 predicted 348
5 SASI_Mm01_00168573 predicted 237
6 SASI_Mm01_00168574 predicted 747
7 SASI_Mm01_00168575 predicted 885
8 SASI_Mm01_00168576 predicted 839
9 SASI_Mm01_00168577 predicted 805
10 SASI_Mm01_00168578 predicted 1643
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020792
VALIDATED
NCEH1 MISSION shRNA Bacterial Glycerol Stock
neutral cholesterol ester hydrolase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020792.4-895s21c1
Sequence:CCGGTATCCAGTTCTTCAAGCTTTACTCGAGTAAAGCTTGAAGAACTGGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020792.4-968s21c1
Sequence:CCGGGCTATGTCATGGTGAAGTATTCTCGAGAATACTTCACCATGACATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_020792.4-700s21c1
Sequence:CCGGCCTGAGCAAATTCATGATGTTCTCGAGAACATCATGAATTTGCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020792.2-3466s1c1
Sequence:CCGGCCTCTCCTTATGTGGTGGTTTCTCGAGAAACCACCACATAAGGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020792.2-705s1c1
Sequence:CCGGCCTGAGCAAATTCATGATGTTCTCGAGAACATCATGAATTTGCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020792.2-972s1c1
Sequence:CCGGCGCTATGTCATGGTGAAGTATCTCGAGATACTTCACCATGACATAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020792.2-973s1c1
Sequence:CCGGGCTATGTCATGGTGAAGTATTCTCGAGAATACTTCACCATGACATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303794    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020792.4-1698s21c1
Sequence:CCGGTGTTATCTTAGCCAACTATACCTCGAGGTATAGTTGGCTAAGATAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020792.4-653s21c1
Sequence:CCGGCTGTCATTGTTTCCATTGAATCTCGAGATTCAATGGAAACAATGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020792.2-658s1c1
Sequence:CCGGCTGTCATTGTTTCCATTGAATCTCGAGATTCAATGGAAACAATGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020792
VALIDATED
NCEH1 MISSION shRNA shRNA Plasmid DNA
neutral cholesterol ester hydrolase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020792.4-895s21c1
Sequence:CCGGTATCCAGTTCTTCAAGCTTTACTCGAGTAAAGCTTGAAGAACTGGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020792.4-968s21c1
Sequence:CCGGGCTATGTCATGGTGAAGTATTCTCGAGAATACTTCACCATGACATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_020792.4-700s21c1
Sequence:CCGGCCTGAGCAAATTCATGATGTTCTCGAGAACATCATGAATTTGCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020792.2-3466s1c1
Sequence:CCGGCCTCTCCTTATGTGGTGGTTTCTCGAGAAACCACCACATAAGGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020792.2-705s1c1
Sequence:CCGGCCTGAGCAAATTCATGATGTTCTCGAGAACATCATGAATTTGCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020792.2-972s1c1
Sequence:CCGGCGCTATGTCATGGTGAAGTATCTCGAGATACTTCACCATGACATAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020792.2-973s1c1
Sequence:CCGGGCTATGTCATGGTGAAGTATTCTCGAGAATACTTCACCATGACATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303794    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020792.4-1698s21c1
Sequence:CCGGTGTTATCTTAGCCAACTATACCTCGAGGTATAGTTGGCTAAGATAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020792.4-653s21c1
Sequence:CCGGCTGTCATTGTTTCCATTGAATCTCGAGATTCAATGGAAACAATGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020792.2-658s1c1
Sequence:CCGGCTGTCATTGTTTCCATTGAATCTCGAGATTCAATGGAAACAATGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020792
VALIDATED
NCEH1 MISSION shRNA Lentiviral Transduction Particles
neutral cholesterol ester hydrolase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020792.4-895s21c1
Sequence:CCGGTATCCAGTTCTTCAAGCTTTACTCGAGTAAAGCTTGAAGAACTGGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020792.4-968s21c1
Sequence:CCGGGCTATGTCATGGTGAAGTATTCTCGAGAATACTTCACCATGACATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_020792.4-700s21c1
Sequence:CCGGCCTGAGCAAATTCATGATGTTCTCGAGAACATCATGAATTTGCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020792.2-3466s1c1
Sequence:CCGGCCTCTCCTTATGTGGTGGTTTCTCGAGAAACCACCACATAAGGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020792.2-705s1c1
Sequence:CCGGCCTGAGCAAATTCATGATGTTCTCGAGAACATCATGAATTTGCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020792.2-972s1c1
Sequence:CCGGCGCTATGTCATGGTGAAGTATCTCGAGATACTTCACCATGACATAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020792.2-973s1c1
Sequence:CCGGGCTATGTCATGGTGAAGTATTCTCGAGAATACTTCACCATGACATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303794    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020792.4-1698s21c1
Sequence:CCGGTGTTATCTTAGCCAACTATACCTCGAGGTATAGTTGGCTAAGATAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020792.4-653s21c1
Sequence:CCGGCTGTCATTGTTTCCATTGAATCTCGAGATTCAATGGAAACAATGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020792.2-658s1c1
Sequence:CCGGCTGTCATTGTTTCCATTGAATCTCGAGATTCAATGGAAACAATGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178772
NCEH1 MISSION shRNA Bacterial Glycerol Stock
neutral cholesterol ester hydrolase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178772.2-1257s1c1
Sequence:CCGGCCGGACTAGGAATAGTTACATCTCGAGATGTAACTATTCCTAGTCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178772.2-3456s1c1
Sequence:CCGGCCTCTTCCAATGTTAGTCTTTCTCGAGAAAGACTAACATTGGAAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178772.2-807s1c1
Sequence:CCGGGCGTCATGTCATGGTTAGGTACTCGAGTACCTAACCATGACATGACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178772.2-865s1c1
Sequence:CCGGGAGGCCATGATTGTGAACAATCTCGAGATTGTTCACAATCATGGCCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178772.2-204s1c1
Sequence:CCGGGCAGCAAGTGAGTAACCTGATCTCGAGATCAGGTTACTCACTTGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178772
NCEH1 MISSION shRNA shRNA Plasmid DNA
neutral cholesterol ester hydrolase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178772.2-1257s1c1
Sequence:CCGGCCGGACTAGGAATAGTTACATCTCGAGATGTAACTATTCCTAGTCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178772.2-3456s1c1
Sequence:CCGGCCTCTTCCAATGTTAGTCTTTCTCGAGAAAGACTAACATTGGAAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178772.2-807s1c1
Sequence:CCGGGCGTCATGTCATGGTTAGGTACTCGAGTACCTAACCATGACATGACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178772.2-865s1c1
Sequence:CCGGGAGGCCATGATTGTGAACAATCTCGAGATTGTTCACAATCATGGCCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178772.2-204s1c1
Sequence:CCGGGCAGCAAGTGAGTAACCTGATCTCGAGATCAGGTTACTCACTTGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178772
NCEH1 MISSION shRNA Lentiviral Transduction Particles
neutral cholesterol ester hydrolase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178772.2-1257s1c1
Sequence:CCGGCCGGACTAGGAATAGTTACATCTCGAGATGTAACTATTCCTAGTCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178772.2-3456s1c1
Sequence:CCGGCCTCTTCCAATGTTAGTCTTTCTCGAGAAAGACTAACATTGGAAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178772.2-807s1c1
Sequence:CCGGGCGTCATGTCATGGTTAGGTACTCGAGTACCTAACCATGACATGACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178772.2-865s1c1
Sequence:CCGGGAGGCCATGATTGTGAACAATCTCGAGATTGTTCACAATCATGGCCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178772.2-204s1c1
Sequence:CCGGGCAGCAAGTGAGTAACCTGATCTCGAGATCAGGTTACTCACTTGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)