EMAIL THIS PAGE TO A FRIEND

NCF2

neutrophil cytosolic factor 2

64 Gene Product Result for
Synonyms: NCF-2 NOXA2 P67-PHOX P67PHOX
Gene ID:
Human(4688) Summary: This gene encodes neutrophil cytosolic factor 2, the 67-kilodalton cytosolic subunit of the multi-protein NADPH oxidase complex found in neutrophils. This oxidase produces a burst of superoxide which is delivered to the lumen of the neutrophil phagosome. Mutations in this gene, as well as in other NADPH oxidase subunits, can result in chronic granulomatous disease, a disease that causes recurrent infections by catalase-positive organisms. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2010]
Mouse(17970) neutrophil cytosolic factor 2
Rat(364018) neutrophil cytosolic factor 2
Zebrafish(562473) neutrophil cytosolic factor 2
chicken(424445) neutrophil cytosolic factor 2
dog(480036) neutrophil cytosolic factor 2
cow(281346) neutrophil cytosolic factor 2
Horse(100051787) neutrophil cytosolic factor 2
domestic cat(101088712) neutrophil cytosolic factor 2
sheep(101106094) neutrophil cytosolic factor 2
domestic guinea pig(100733153) neutrophil cytosolic factor 2
Domestic Rabbit(100008802) neutrophil cytosolic factor 2
naked mole-rat(101716459) neutrophil cytosolic factor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010877 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010877 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010877 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000433 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000433 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000433 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000433 Rosetta Predictions human pricing
NM_001127651 Rosetta Predictions human pricing
NM_001100984 Rosetta Predictions rat pricing
NM_010877 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000433 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157951 predicted 1812
2 SASI_Hs01_00157952 predicted 1722
3 SASI_Hs01_00157953 predicted 1727
4 SASI_Hs01_00157954 predicted 541
5 SASI_Hs01_00157955 predicted 1613
6 SASI_Hs01_00157956 predicted 687
7 SASI_Hs01_00157957 predicted 1842
8 SASI_Hs01_00157958 predicted 1667
9 SASI_Hs01_00157959 predicted 544
10 SASI_Hs02_00302542 predicted 632
11 SASI_Hs01_00157960 predicted 1599
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127651 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329994 predicted 1639
2 SASI_Hs02_00329995 predicted 1549
3 SASI_Hs02_00329996 predicted 1558
4 SASI_Hs02_00329997 predicted 369
5 SASI_Hs02_00329998 predicted 1440
6 SASI_Hs02_00329999 predicted 515
7 SASI_Hs02_00330000 predicted 1663
8 SASI_Hs02_00330001 predicted 1490
9 SASI_Hs02_00330002 predicted 371
10 SASI_Hs02_00330003 predicted 458
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100984 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210982 predicted 417
2 SASI_Rn02_00210983 predicted 245
3 SASI_Rn02_00210984 predicted 381
4 SASI_Rn02_00210985 predicted 1340
5 SASI_Rn02_00210986 predicted 1046
6 SASI_Rn02_00210987 predicted 534
7 SASI_Rn02_00210988 predicted 322
8 SASI_Rn02_00210989 predicted 292
9 SASI_Rn02_00210990 predicted 891
10 SASI_Rn02_00210991 predicted 759
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010877 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186591 predicted 729
2 SASI_Mm01_00186593 predicted 1764
3 SASI_Mm01_00186594 predicted 962
4 SASI_Mm01_00186595 predicted 1579
5 SASI_Mm01_00186596 predicted 1549
6 SASI_Mm01_00186597 predicted 752
7 SASI_Mm01_00186599 predicted 1013
8 SASI_Mm02_00319556 predicted 1027
9 SASI_Mm02_00319557 predicted 1065
10 SASI_Mm02_00319558 predicted 498
11 SASI_Mm01_00186590 predicted 1685
12 SASI_Mm01_00186592 predicted 1789
13 SASI_Mm01_00186598 predicted 1798
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010877
NCF2 MISSION shRNA Bacterial Glycerol Stock
neutrophil cytosolic factor 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255505    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010877.4-1820s21c1
Sequence:CCGGACTTACCATTTCCCTATTAAACTCGAGTTTAATAGGGAAATGGTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010877.4-1072s21c1
Sequence:CCGGTACCTCTCCAGAATCCGATATCTCGAGATATCGGATTCTGGAGAGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010877.2-2221s1c1
Sequence:CCGGCCAAGGAGAATGGAACTCTTACTCGAGTAAGAGTTCCATTCTCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010877.2-1686s1c1
Sequence:CCGGGCCAAGAATTTGGAAGGCATTCTCGAGAATGCCTTCCAAATTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010877.2-407s1c1
Sequence:CCGGCCTTGCTATCAAAGACCTTAACTCGAGTTAAGGTCTTTGATAGCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010877.2-1262s1c1
Sequence:CCGGGCTTCGGAACATGGTGTCTAACTCGAGTTAGACACCATGTTCCGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010877.2-1184s1c1
Sequence:CCGGGCCTATGCCTTACATGCTCAACTCGAGTTGAGCATGTAAGGCATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010877.4-927s21c1
Sequence:CCGGTGCCTGGGAACATCGTCTTTGCTCGAGCAAAGACGATGTTCCCAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010877.4-1427s21c1
Sequence:CCGGGTGGGTGACCAAGGTCTTATTCTCGAGAATAAGACCTTGGTCACCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010877
NCF2 MISSION shRNA shRNA Plasmid DNA
neutrophil cytosolic factor 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255505    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010877.4-1820s21c1
Sequence:CCGGACTTACCATTTCCCTATTAAACTCGAGTTTAATAGGGAAATGGTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010877.4-1072s21c1
Sequence:CCGGTACCTCTCCAGAATCCGATATCTCGAGATATCGGATTCTGGAGAGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010877.2-2221s1c1
Sequence:CCGGCCAAGGAGAATGGAACTCTTACTCGAGTAAGAGTTCCATTCTCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010877.2-1686s1c1
Sequence:CCGGGCCAAGAATTTGGAAGGCATTCTCGAGAATGCCTTCCAAATTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010877.2-407s1c1
Sequence:CCGGCCTTGCTATCAAAGACCTTAACTCGAGTTAAGGTCTTTGATAGCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010877.2-1262s1c1
Sequence:CCGGGCTTCGGAACATGGTGTCTAACTCGAGTTAGACACCATGTTCCGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010877.2-1184s1c1
Sequence:CCGGGCCTATGCCTTACATGCTCAACTCGAGTTGAGCATGTAAGGCATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010877.4-927s21c1
Sequence:CCGGTGCCTGGGAACATCGTCTTTGCTCGAGCAAAGACGATGTTCCCAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010877.4-1427s21c1
Sequence:CCGGGTGGGTGACCAAGGTCTTATTCTCGAGAATAAGACCTTGGTCACCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010877
NCF2 MISSION shRNA Lentiviral Transduction Particles
neutrophil cytosolic factor 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255505    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010877.4-1820s21c1
Sequence:CCGGACTTACCATTTCCCTATTAAACTCGAGTTTAATAGGGAAATGGTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010877.4-1072s21c1
Sequence:CCGGTACCTCTCCAGAATCCGATATCTCGAGATATCGGATTCTGGAGAGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010877.2-2221s1c1
Sequence:CCGGCCAAGGAGAATGGAACTCTTACTCGAGTAAGAGTTCCATTCTCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010877.2-1686s1c1
Sequence:CCGGGCCAAGAATTTGGAAGGCATTCTCGAGAATGCCTTCCAAATTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010877.2-407s1c1
Sequence:CCGGCCTTGCTATCAAAGACCTTAACTCGAGTTAAGGTCTTTGATAGCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010877.2-1262s1c1
Sequence:CCGGGCTTCGGAACATGGTGTCTAACTCGAGTTAGACACCATGTTCCGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010877.2-1184s1c1
Sequence:CCGGGCCTATGCCTTACATGCTCAACTCGAGTTGAGCATGTAAGGCATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010877.4-927s21c1
Sequence:CCGGTGCCTGGGAACATCGTCTTTGCTCGAGCAAAGACGATGTTCCCAGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010877.4-1427s21c1
Sequence:CCGGGTGGGTGACCAAGGTCTTATTCTCGAGAATAAGACCTTGGTCACCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000433
NCF2 MISSION shRNA Bacterial Glycerol Stock
neutrophil cytosolic factor 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000433.1-1608s1c1
Sequence:CCGGGCGCAACTACAGATTTGGAAACTCGAGTTTCCAAATCTGTAGTTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000433.1-461s1c1
Sequence:CCGGGCCAAGAAGGAGGAATGGAAACTCGAGTTTCCATTCCTCCTTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000433.1-1193s1c1
Sequence:CCGGCGGGACATGGTGTCTAAGAAACTCGAGTTTCTTAGACACCATGTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000433.1-1519s1c1
Sequence:CCGGCCTGGTGTTATCAAAGGTGAACTCGAGTTCACCTTTGATAACACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000433.1-335s1c1
Sequence:CCGGGCTATCAAAGACCTTAAAGAACTCGAGTTCTTTAAGGTCTTTGATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000433
NCF2 MISSION shRNA shRNA Plasmid DNA
neutrophil cytosolic factor 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000433.1-1608s1c1
Sequence:CCGGGCGCAACTACAGATTTGGAAACTCGAGTTTCCAAATCTGTAGTTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000433.1-461s1c1
Sequence:CCGGGCCAAGAAGGAGGAATGGAAACTCGAGTTTCCATTCCTCCTTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000433.1-1193s1c1
Sequence:CCGGCGGGACATGGTGTCTAAGAAACTCGAGTTTCTTAGACACCATGTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000433.1-1519s1c1
Sequence:CCGGCCTGGTGTTATCAAAGGTGAACTCGAGTTCACCTTTGATAACACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000433.1-335s1c1
Sequence:CCGGGCTATCAAAGACCTTAAAGAACTCGAGTTCTTTAAGGTCTTTGATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000433
NCF2 MISSION shRNA Lentiviral Transduction Particles
neutrophil cytosolic factor 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000433.1-1608s1c1
Sequence:CCGGGCGCAACTACAGATTTGGAAACTCGAGTTTCCAAATCTGTAGTTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000433.1-461s1c1
Sequence:CCGGGCCAAGAAGGAGGAATGGAAACTCGAGTTTCCATTCCTCCTTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000433.1-1193s1c1
Sequence:CCGGCGGGACATGGTGTCTAAGAAACTCGAGTTTCTTAGACACCATGTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000433.1-1519s1c1
Sequence:CCGGCCTGGTGTTATCAAAGGTGAACTCGAGTTCACCTTTGATAACACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000433.1-335s1c1
Sequence:CCGGGCTATCAAAGACCTTAAAGAACTCGAGTTCTTTAAGGTCTTTGATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)