EMAIL THIS PAGE TO A FRIEND

NCF4

neutrophil cytosolic factor 4, 40kDa

70 Gene Product Result for
Synonyms: NCF P40PHOX SH3PXD4
UniProtKB ID: Q15080, A8K4F9, O60808, Q86U56, Q9BU98, Q9NP45
Gene ID:
Human(4689) Summary: The protein encoded by this gene is a cytosolic regulatory component of the superoxide-producing phagocyte NADPH-oxidase, a multicomponent enzyme system important for host defense. This protein is preferentially expressed in cells of myeloid lineage. It interacts primarily with neutrophil cytosolic factor 2 (NCF2/p67-phox) to form a complex with neutrophil cytosolic factor 1 (NCF1/p47-phox), which further interacts with the small G protein RAC1 and translocates to the membrane upon cell stimulation. This complex then activates flavocytochrome b, the membrane-integrated catalytic core of the enzyme system. The PX domain of this protein can bind phospholipid products of the PI(3) kinase, which suggests its role in PI(3) kinase-mediated signaling events. The phosphorylation of this protein was found to negatively regulate the enzyme activity. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Mouse(17972) neutrophil cytosolic factor 4
Rat(500904) neutrophil cytosolic factor 4
sheep(101122939) neutrophil cytosolic factor 4, 40kDa
naked mole-rat(101699188) neutrophil cytosolic factor 4, 40kDa
Domestic Rabbit(100009359) neutrophil cytosolic factor 4, 40kDa
domestic guinea pig(100729267) neutrophil cytosolic factor 4, 40kDa
Zebrafish(403014) neutrophil cytosolic factor 4
chicken(418052) neutrophil cytosolic factor 4, 40kDa
domestic cat(101095507) neutrophil cytosolic factor 4, 40kDa
cow(507859) neutrophil cytosolic factor 4, 40kDa
Horse(100069566) neutrophil cytosolic factor 4, 40kDa
dog(481277) neutrophil cytosolic factor 4, 40kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008677 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008677 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008677 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000631 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000631 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000631 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000631 Rosetta Predictions human pricing
NM_013416 Rosetta Predictions human pricing
NM_001127304 Rosetta Predictions rat pricing
NM_008677 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000631 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032279 predicted 706
2 SASI_Hs01_00032280 predicted 704
3 SASI_Hs02_00302977 predicted 205
4 SASI_Hs01_00032281 predicted 285
5 SASI_Hs01_00032282 predicted 436
6 SASI_Hs01_00032284 predicted 332
7 SASI_Hs01_00032286 predicted 668
8 SASI_Hs02_00302978 predicted 325
9 SASI_Hs01_00032287 predicted 1169
10 SASI_Hs01_00032288 predicted 356
11 SASI_Hs01_00032283 predicted 208
12 SASI_Hs01_00032285 predicted 217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013416 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020451 predicted 708
2 SASI_Hs01_00020452 predicted 698
3 SASI_Hs02_00344802 predicted 209
4 SASI_Hs01_00020453 predicted 276
5 SASI_Hs01_00020454 predicted 443
6 SASI_Hs01_00020456 predicted 326
7 SASI_Hs01_00020458 predicted 673
8 SASI_Hs02_00344803 predicted 324
9 SASI_Hs01_00020459 predicted 1415
10 SASI_Hs01_00020460 predicted 362
11 SASI_Hs01_00020455 predicted 207
12 SASI_Hs01_00020457 predicted 223
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127304 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253603 predicted 341
2 SASI_Rn02_00253604 predicted 811
3 SASI_Rn02_00253605 predicted 441
4 SASI_Rn02_00253606 predicted 400
5 SASI_Rn02_00253607 predicted 246
6 SASI_Rn02_00253608 predicted 1212
7 SASI_Rn02_00253609 predicted 810
8 SASI_Rn02_00253610 predicted 936
9 SASI_Rn02_00253611 predicted 381
10 SASI_Rn02_00253612 predicted 1070
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008677 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110428 predicted 431
2 SASI_Mm01_00110429 predicted 802
3 SASI_Mm01_00110430 predicted 320
4 SASI_Mm02_00314449 predicted 431
5 SASI_Mm01_00110431 predicted 751
6 SASI_Mm01_00110432 predicted 618
7 SASI_Mm01_00110433 predicted 801
8 SASI_Mm01_00110434 predicted 881
9 SASI_Mm01_00110435 predicted 599
10 SASI_Mm01_00110436 predicted 367
11 SASI_Mm01_00110437 predicted 490
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008677
NCF4 MISSION shRNA Bacterial Glycerol Stock
neutrophil cytosolic factor 4, 40kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070668    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008677.1-1274s1c1
Sequence:CCGGCTCAGCAAAGGGCCTTTACTTCTCGAGAAGTAAAGGCCCTTTGCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008677.1-495s1c1
Sequence:CCGGCAAAGTCTACATGGGCGCAAACTCGAGTTTGCGCCCATGTAGACTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008677.1-787s1c1
Sequence:CCGGCTAAGTTTCAAAGCTGGAGATCTCGAGATCTCCAGCTTTGAAACTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008677.1-817s1c1
Sequence:CCGGCTTCTCAGTAAGATCAACAAACTCGAGTTTGTTGATCTTACTGAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008677.1-936s1c1
Sequence:CCGGCTGGCTACGATGCTACTTCTACTCGAGTAGAAGTAGCATCGTAGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008677
NCF4 MISSION shRNA shRNA Plasmid DNA
neutrophil cytosolic factor 4, 40kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070668    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008677.1-1274s1c1
Sequence:CCGGCTCAGCAAAGGGCCTTTACTTCTCGAGAAGTAAAGGCCCTTTGCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008677.1-495s1c1
Sequence:CCGGCAAAGTCTACATGGGCGCAAACTCGAGTTTGCGCCCATGTAGACTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008677.1-787s1c1
Sequence:CCGGCTAAGTTTCAAAGCTGGAGATCTCGAGATCTCCAGCTTTGAAACTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008677.1-817s1c1
Sequence:CCGGCTTCTCAGTAAGATCAACAAACTCGAGTTTGTTGATCTTACTGAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008677.1-936s1c1
Sequence:CCGGCTGGCTACGATGCTACTTCTACTCGAGTAGAAGTAGCATCGTAGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008677
NCF4 MISSION shRNA Lentiviral Transduction Particles
neutrophil cytosolic factor 4, 40kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070668    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008677.1-1274s1c1
Sequence:CCGGCTCAGCAAAGGGCCTTTACTTCTCGAGAAGTAAAGGCCCTTTGCTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008677.1-495s1c1
Sequence:CCGGCAAAGTCTACATGGGCGCAAACTCGAGTTTGCGCCCATGTAGACTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008677.1-787s1c1
Sequence:CCGGCTAAGTTTCAAAGCTGGAGATCTCGAGATCTCCAGCTTTGAAACTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008677.1-817s1c1
Sequence:CCGGCTTCTCAGTAAGATCAACAAACTCGAGTTTGTTGATCTTACTGAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008677.1-936s1c1
Sequence:CCGGCTGGCTACGATGCTACTTCTACTCGAGTAGAAGTAGCATCGTAGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000631
NCF4 MISSION shRNA Bacterial Glycerol Stock
neutrophil cytosolic factor 4, 40kDa
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000631.2-720s1c1
Sequence:CCGGGCTGAATTTCAAAGCTGGAGACTCGAGTCTCCAGCTTTGAAATTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000631.2-994s1c1
Sequence:CCGGAGAGAGGACATAGCTCTGAATCTCGAGATTCAGAGCTATGTCCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000631.2-438s1c1
Sequence:CCGGCGTGGGTGTGAAACAGGAGATCTCGAGATCTCCTGTTTCACACCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000631.2-825s1c1
Sequence:CCGGCGTGAAGATCCTCAAAGACTTCTCGAGAAGTCTTTGAGGATCTTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000631.2-183s1c1
Sequence:CCGGCGAGAGTGACTTTGAACAGCTCTCGAGAGCTGTTCAAAGTCACTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000631.4-561s21c1
Sequence:CCGGATGAGGACGTCCGGATCTTCTCTCGAGAGAAGATCCGGACGTCCTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000631.4-904s21c1
Sequence:CCGGGCGTTGCTACTACTACGAAGACTCGAGTCTTCGTAGTAGTAGCAACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000631
NCF4 MISSION shRNA shRNA Plasmid DNA
neutrophil cytosolic factor 4, 40kDa
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000631.2-720s1c1
Sequence:CCGGGCTGAATTTCAAAGCTGGAGACTCGAGTCTCCAGCTTTGAAATTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000631.2-994s1c1
Sequence:CCGGAGAGAGGACATAGCTCTGAATCTCGAGATTCAGAGCTATGTCCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000631.2-438s1c1
Sequence:CCGGCGTGGGTGTGAAACAGGAGATCTCGAGATCTCCTGTTTCACACCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000631.2-825s1c1
Sequence:CCGGCGTGAAGATCCTCAAAGACTTCTCGAGAAGTCTTTGAGGATCTTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000631.2-183s1c1
Sequence:CCGGCGAGAGTGACTTTGAACAGCTCTCGAGAGCTGTTCAAAGTCACTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000446012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000631.4-561s21c1
Sequence:CCGGATGAGGACGTCCGGATCTTCTCTCGAGAGAAGATCCGGACGTCCTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000631.4-904s21c1
Sequence:CCGGGCGTTGCTACTACTACGAAGACTCGAGTCTTCGTAGTAGTAGCAACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000631
NCF4 MISSION shRNA Lentiviral Transduction Particles
neutrophil cytosolic factor 4, 40kDa
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000631.2-720s1c1
Sequence:CCGGGCTGAATTTCAAAGCTGGAGACTCGAGTCTCCAGCTTTGAAATTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000631.2-994s1c1
Sequence:CCGGAGAGAGGACATAGCTCTGAATCTCGAGATTCAGAGCTATGTCCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000631.2-438s1c1
Sequence:CCGGCGTGGGTGTGAAACAGGAGATCTCGAGATCTCCTGTTTCACACCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000631.2-825s1c1
Sequence:CCGGCGTGAAGATCCTCAAAGACTTCTCGAGAAGTCTTTGAGGATCTTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000631.2-183s1c1
Sequence:CCGGCGAGAGTGACTTTGAACAGCTCTCGAGAGCTGTTCAAAGTCACTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000631.4-561s21c1
Sequence:CCGGATGAGGACGTCCGGATCTTCTCTCGAGAGAAGATCCGGACGTCCTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000631.4-904s21c1
Sequence:CCGGGCGTTGCTACTACTACGAAGACTCGAGTCTTCGTAGTAGTAGCAACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)