EMAIL THIS PAGE TO A FRIEND

NCK1

NCK adaptor protein 1

109 Gene Product Result for
Synonyms: NCK NCKalpha nck-1
UniProtKB ID: P16333, B7Z751, D3DNE3
Gene ID:
Human(4690) Summary: The protein encoded by this gene is one of the signaling and transforming proteins containing Src homology 2 and 3 (SH2 and SH3) domains. It is located in the cytoplasm and is an adaptor protein involved in transducing signals from receptor tyrosine kinases to downstream signal recipients such as RAS. Alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, Jun 2010]
Mouse(17973) non-catalytic region of tyrosine kinase adaptor protein 1
Rat(300955) NCK adaptor protein 1
cow(536154) NCK adaptor protein 1
Horse(100053397) NCK adaptor protein 1
domestic cat(101094695) NCK adaptor protein 1
dog(485677) NCK adaptor protein 1
sheep(100307045) NCK adaptor protein 1
domestic guinea pig(100730115) NCK adaptor protein 1
Domestic Rabbit(100358703) NCK adaptor protein 1
naked mole-rat(101702437) NCK adaptor protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006153 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006153 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006153 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010878 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010878 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010878 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006153 Rosetta Predictions human pricing
NM_001106851 Rosetta Predictions rat pricing
XM_217246 Rosetta Predictions rat pricing
NM_010878 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006153 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133204 predicted 409
2 SASI_Hs01_00133205 predicted 742
3 SASI_Hs01_00133206 predicted 857
4 SASI_Hs01_00133208 predicted 747
5 SASI_Hs01_00133209 predicted 1122
6 SASI_Hs01_00133210 predicted 803
7 SASI_Hs01_00133211 predicted 1031
8 SASI_Hs01_00133212 predicted 972
9 SASI_Hs02_00340988 predicted 713
10 SASI_Hs01_00133213 predicted 1041
11 SASI_Hs01_00133207 predicted 1163
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106851 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223026 predicted 767
2 SASI_Rn02_00223027 predicted 1315
3 SASI_Rn02_00223028 predicted 375
4 SASI_Rn02_00223029 predicted 1182
5 SASI_Rn02_00223030 predicted 207
6 SASI_Rn02_00223031 predicted 1141
7 SASI_Rn02_00223032 predicted 637
8 SASI_Rn02_00223033 predicted 1271
9 SASI_Rn02_00223034 predicted 1061
10 SASI_Rn02_00223035 predicted 665
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_217246 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00171678 predicted 542
2 SASI_Rn01_00171679 predicted 1090
3 SASI_Rn01_00171680 predicted 778
4 SASI_Rn01_00171681 predicted 955
5 SASI_Rn01_00171682 predicted 921
6 SASI_Rn01_00171683 predicted 1056
7 SASI_Rn01_00171684 predicted 843
8 SASI_Rn01_00171685 predicted 436
9 SASI_Rn01_00171686 predicted 586
10 SASI_Rn01_00171687 predicted 470
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010878 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319559 predicted 682
2 SASI_Mm01_00134600 predicted 1225
3 SASI_Mm02_00319560 predicted 1126
4 SASI_Mm01_00134604 predicted 809
5 SASI_Mm02_00319561 predicted 352
6 SASI_Mm02_00319562 predicted 1081
7 SASI_Mm01_00134605 predicted 633
8 SASI_Mm02_00319563 predicted 613
9 SASI_Mm02_00319564 predicted 625
10 SASI_Mm01_00134606 predicted 1155
11 SASI_Mm01_00134601 predicted 1310
12 SASI_Mm01_00134602 predicted 1310
13 SASI_Mm01_00134603 predicted 955
14 SASI_Mm01_00134607 predicted 1278
15 SASI_Mm01_00134608 predicted 1202
16 SASI_Mm01_00134609 predicted 1258
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006153
NCK1 MISSION shRNA Bacterial Glycerol Stock
NCK adaptor protein 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006153.3-1032s21c1
Sequence:CCGGGATAGTGAATCTTCGCCAAATCTCGAGATTTGGCGAAGATTCACTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006153.3-424s21c1
Sequence:CCGGACCTCAACATGCCCGCTTATGCTCGAGCATAAGCGGGCATGTTGAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006153.3-1133s1c1
Sequence:CCGGGCAGCGTAAATTCAGCACCATCTCGAGATGGTGCTGAATTTACGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006153.3-224s1c1
Sequence:CCGGGCGAGTTCGAAATTCCATGAACTCGAGTTCATGGAATTTCGAACTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122929    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006153.3-1755s1c1
Sequence:CCGGGCCATTGTAAATACCAAGTATCTCGAGATACTTGGTATTTACAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006153.3-648s1c1
Sequence:CCGGGCAGTCGTCAATAACCTAAATCTCGAGATTTAGGTTATTGACGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006153.3-645s1c1
Sequence:CCGGGCAGCAGTCGTCAATAACCTACTCGAGTAGGTTATTGACGACTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006153
NCK1 MISSION shRNA shRNA Plasmid DNA
NCK adaptor protein 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006153.3-1032s21c1
Sequence:CCGGGATAGTGAATCTTCGCCAAATCTCGAGATTTGGCGAAGATTCACTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006153.3-424s21c1
Sequence:CCGGACCTCAACATGCCCGCTTATGCTCGAGCATAAGCGGGCATGTTGAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006153.3-1133s1c1
Sequence:CCGGGCAGCGTAAATTCAGCACCATCTCGAGATGGTGCTGAATTTACGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006153.3-224s1c1
Sequence:CCGGGCGAGTTCGAAATTCCATGAACTCGAGTTCATGGAATTTCGAACTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122929    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006153.3-1755s1c1
Sequence:CCGGGCCATTGTAAATACCAAGTATCTCGAGATACTTGGTATTTACAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006153.3-648s1c1
Sequence:CCGGGCAGTCGTCAATAACCTAAATCTCGAGATTTAGGTTATTGACGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006153.3-645s1c1
Sequence:CCGGGCAGCAGTCGTCAATAACCTACTCGAGTAGGTTATTGACGACTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006153
NCK1 MISSION shRNA Lentiviral Transduction Particles
NCK adaptor protein 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006153.3-1032s21c1
Sequence:CCGGGATAGTGAATCTTCGCCAAATCTCGAGATTTGGCGAAGATTCACTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006153.3-424s21c1
Sequence:CCGGACCTCAACATGCCCGCTTATGCTCGAGCATAAGCGGGCATGTTGAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006153.3-1133s1c1
Sequence:CCGGGCAGCGTAAATTCAGCACCATCTCGAGATGGTGCTGAATTTACGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006153.3-224s1c1
Sequence:CCGGGCGAGTTCGAAATTCCATGAACTCGAGTTCATGGAATTTCGAACTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122929    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006153.3-1755s1c1
Sequence:CCGGGCCATTGTAAATACCAAGTATCTCGAGATACTTGGTATTTACAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006153.3-648s1c1
Sequence:CCGGGCAGTCGTCAATAACCTAAATCTCGAGATTTAGGTTATTGACGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006153.3-645s1c1
Sequence:CCGGGCAGCAGTCGTCAATAACCTACTCGAGTAGGTTATTGACGACTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010878
VALIDATED
NCK1 MISSION shRNA Bacterial Glycerol Stock
NCK adaptor protein 1
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362657    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010878.2-1303s21c1
Sequence:CCGGAGTGCTGTTTCTAACTATATGCTCGAGCATATAGTTAGAAACAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337633    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010878.2-1357s21c1
Sequence:CCGGTAACTCAGCCCATACGTATATCTCGAGATATACGTATGGGCTGAGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010878.2-145s21c1
Sequence:CCGGTCAAGAAGAATGAGCGATTATCTCGAGATAATCGCTCATTCTTCTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010878.2-1022s21c1
Sequence:CCGGTGATTTCTCAGTATCACTAAACTCGAGTTTAGTGATACTGAGAAATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010878.2-716s21c1
Sequence:CCGGAGGCGATGTAATGGATGTTATCTCGAGATAACATCCATTACATCGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010878.2-512s21c1
Sequence:CCGGTGGCAGCTACAACGGACAAATCTCGAGATTTGTCCGTTGTAGCTGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010878.2-187s21c1
Sequence:CCGGCCTGGTGGCGAGTTCGAAATTCTCGAGAATTTCGAACTCGCCACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010878.2-543s1c1
Sequence:CCGGCCTTCAAACTATGTAACTGAACTCGAGTTCAGTTACATAGTTTGAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010878.2-960s1c1
Sequence:CCGGGCATTAAATGAAAGAGGGCATCTCGAGATGCCCTCTTTCATTTAATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010878.2-354s1c1
Sequence:CCGGGCTGATGATAGCTTTGTTGATCTCGAGATCAACAAAGCTATCATCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010878.2-1155s1c1
Sequence:CCGGCCGATCTTTACAAGTGAGCAACTCGAGTTGCTCACTTGTAAAGATCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010878.2-910s21c1
Sequence:CCGGCTGGCAATCCTTGGTATTATGCTCGAGCATAATACCAAGGATTGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010878.2-618s1c1
Sequence:CCGGGCAGTTGTCAATAACCTAAATCTCGAGATTTAGGTTATTGACAACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010878
VALIDATED
NCK1 MISSION shRNA shRNA Plasmid DNA
NCK adaptor protein 1
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362657    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010878.2-1303s21c1
Sequence:CCGGAGTGCTGTTTCTAACTATATGCTCGAGCATATAGTTAGAAACAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337633    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010878.2-1357s21c1
Sequence:CCGGTAACTCAGCCCATACGTATATCTCGAGATATACGTATGGGCTGAGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010878.2-145s21c1
Sequence:CCGGTCAAGAAGAATGAGCGATTATCTCGAGATAATCGCTCATTCTTCTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010878.2-1022s21c1
Sequence:CCGGTGATTTCTCAGTATCACTAAACTCGAGTTTAGTGATACTGAGAAATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010878.2-716s21c1
Sequence:CCGGAGGCGATGTAATGGATGTTATCTCGAGATAACATCCATTACATCGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010878.2-512s21c1
Sequence:CCGGTGGCAGCTACAACGGACAAATCTCGAGATTTGTCCGTTGTAGCTGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010878.2-187s21c1
Sequence:CCGGCCTGGTGGCGAGTTCGAAATTCTCGAGAATTTCGAACTCGCCACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010878.2-543s1c1
Sequence:CCGGCCTTCAAACTATGTAACTGAACTCGAGTTCAGTTACATAGTTTGAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010878.2-960s1c1
Sequence:CCGGGCATTAAATGAAAGAGGGCATCTCGAGATGCCCTCTTTCATTTAATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010878.2-354s1c1
Sequence:CCGGGCTGATGATAGCTTTGTTGATCTCGAGATCAACAAAGCTATCATCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010878.2-1155s1c1
Sequence:CCGGCCGATCTTTACAAGTGAGCAACTCGAGTTGCTCACTTGTAAAGATCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010878.2-910s21c1
Sequence:CCGGCTGGCAATCCTTGGTATTATGCTCGAGCATAATACCAAGGATTGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010878.2-618s1c1
Sequence:CCGGGCAGTTGTCAATAACCTAAATCTCGAGATTTAGGTTATTGACAACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010878
VALIDATED
NCK1 MISSION shRNA Lentiviral Transduction Particles
NCK adaptor protein 1
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362657    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010878.2-1303s21c1
Sequence:CCGGAGTGCTGTTTCTAACTATATGCTCGAGCATATAGTTAGAAACAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337633    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010878.2-1357s21c1
Sequence:CCGGTAACTCAGCCCATACGTATATCTCGAGATATACGTATGGGCTGAGTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010878.2-145s21c1
Sequence:CCGGTCAAGAAGAATGAGCGATTATCTCGAGATAATCGCTCATTCTTCTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010878.2-1022s21c1
Sequence:CCGGTGATTTCTCAGTATCACTAAACTCGAGTTTAGTGATACTGAGAAATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010878.2-716s21c1
Sequence:CCGGAGGCGATGTAATGGATGTTATCTCGAGATAACATCCATTACATCGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010878.2-512s21c1
Sequence:CCGGTGGCAGCTACAACGGACAAATCTCGAGATTTGTCCGTTGTAGCTGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010878.2-187s21c1
Sequence:CCGGCCTGGTGGCGAGTTCGAAATTCTCGAGAATTTCGAACTCGCCACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010878.2-543s1c1
Sequence:CCGGCCTTCAAACTATGTAACTGAACTCGAGTTCAGTTACATAGTTTGAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010878.2-960s1c1
Sequence:CCGGGCATTAAATGAAAGAGGGCATCTCGAGATGCCCTCTTTCATTTAATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010878.2-354s1c1
Sequence:CCGGGCTGATGATAGCTTTGTTGATCTCGAGATCAACAAAGCTATCATCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010878.2-1155s1c1
Sequence:CCGGCCGATCTTTACAAGTGAGCAACTCGAGTTGCTCACTTGTAAAGATCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010878.2-910s21c1
Sequence:CCGGCTGGCAATCCTTGGTATTATGCTCGAGCATAATACCAAGGATTGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010878.2-618s1c1
Sequence:CCGGGCAGTTGTCAATAACCTAAATCTCGAGATTTAGGTTATTGACAACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)