EMAIL THIS PAGE TO A FRIEND

NCK2

NCK adaptor protein 2

158 Gene Product Result for
Synonyms: GRB4 NCKbeta
UniProtKB ID: O43639, D3DVK1, Q9BWN9, Q9UIC3
Gene ID:
Human(8440) Summary: This gene encodes a member of the NCK family of adaptor proteins. The protein contains three SH3 domains and one SH2 domain. The protein has no known catalytic function but has been shown to bind and recruit various proteins involved in the regulation of receptor protein tyrosine kinases. It is through these regulatory activities that this protein is believed to be involved in cytoskeletal reorganization. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Mouse(17974) non-catalytic region of tyrosine kinase adaptor protein 2
Rat(316369) NCK adaptor protein 2
chicken(418727) NCK adaptor protein 2
dog(481319) NCK adaptor protein 2
Horse(100049884) NCK adaptor protein 2
cow(526430) NCK adaptor protein 2
domestic cat(101099871) NCK adaptor protein 2
naked mole-rat(101720865) NCK adaptor protein 2
Domestic Rabbit(100353755) NCK adaptor protein 2
domestic guinea pig(100733044) NCK adaptor protein 2
sheep(101114255) NCK adaptor protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003581 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003581 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003581 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010879 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010879 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010879 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004720 Rosetta Predictions human pricing
NM_001004722 Rosetta Predictions human pricing
NM_003581 Rosetta Predictions human pricing
NM_001108216 Rosetta Predictions rat pricing
NM_010879 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004720 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174379 predicted 1429
2 SASI_Hs01_00174382 predicted 1314
3 SASI_Hs01_00174383 predicted 1301
4 SASI_Hs01_00174384 predicted 1326
5 SASI_Hs01_00174385 predicted 1301
6 SASI_Hs01_00174387 predicted 1340
7 SASI_Hs01_00174388 predicted 1341
8 SASI_Hs02_00304673 predicted 1671
9 SASI_Hs02_00304674 predicted 1641
10 SASI_Hs02_00304675 predicted 1669
11 SASI_Hs01_00174380 predicted 1428
12 SASI_Hs01_00174381 predicted 1314
13 SASI_Hs01_00174386 predicted 1428
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004722 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033199 predicted 1076
2 SASI_Hs01_00033202 predicted 964
3 SASI_Hs01_00033203 predicted 953
4 SASI_Hs01_00033204 predicted 980
5 SASI_Hs01_00033205 predicted 950
6 SASI_Hs01_00033207 predicted 990
7 SASI_Hs01_00033208 predicted 996
8 SASI_Hs02_00304676 predicted 1124
9 SASI_Hs02_00304677 predicted 670
10 SASI_Hs02_00304678 predicted 592
11 SASI_Hs01_00033200 predicted 1086
12 SASI_Hs01_00033201 predicted 974
13 SASI_Hs01_00033206 predicted 1090
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003581 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111864 predicted 1801
2 SASI_Hs01_00111867 predicted 1687
3 SASI_Hs01_00111868 predicted 1675
4 SASI_Hs01_00111869 predicted 1711
5 SASI_Hs01_00111870 predicted 1678
6 SASI_Hs01_00111872 predicted 1719
7 SASI_Hs01_00111873 predicted 1714
8 SASI_Hs02_00335895 predicted 2054
9 SASI_Hs02_00335896 predicted 2019
10 SASI_Hs02_00335897 predicted 2047
11 SASI_Hs01_00111865 predicted 1808
12 SASI_Hs01_00111866 predicted 1693
13 SASI_Hs01_00111871 predicted 1806
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108216 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236464 predicted 414
2 SASI_Rn02_00236465 predicted 634
3 SASI_Rn02_00236466 predicted 1214
4 SASI_Rn02_00236467 predicted 889
5 SASI_Rn02_00236468 predicted 1198
6 SASI_Rn02_00236469 predicted 886
7 SASI_Rn02_00236470 predicted 1241
8 SASI_Rn02_00236471 predicted 1241
9 SASI_Rn02_00236472 predicted 1091
10 SASI_Rn02_00236473 predicted 1106
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010879 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104622 predicted 1853
2 SASI_Mm01_00104623 predicted 1846
3 SASI_Mm01_00104624 predicted 1435
4 SASI_Mm01_00104626 predicted 598
5 SASI_Mm02_00319565 predicted 858
6 SASI_Mm01_00104627 predicted 1081
7 SASI_Mm02_00319566 predicted 1422
8 SASI_Mm01_00104628 predicted 1821
9 SASI_Mm01_00104629 predicted 1663
10 SASI_Mm01_00104630 predicted 1569
11 SASI_Mm01_00104625 predicted 1084
12 SASI_Mm01_00104631 predicted 1211
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003581
NCK2 MISSION shRNA Bacterial Glycerol Stock
NCK adaptor protein 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434745    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003581.2-2059s21c1
Sequence:CCGGATACGTTTGCTGATAGCAATACTCGAGTATTGCTATCAGCAAACGTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003581.2-1398s21c1
Sequence:CCGGACTTCTCCGTGTCCCTTAAAGCTCGAGCTTTAAGGGACACGGAGAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122914    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003581.2-2264s1c1
Sequence:CCGGGCTTGTTTGAATCTCACAATTCTCGAGAATTGTGAGATTCAAACAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003581.2-585s1c1
Sequence:CCGGCGGGCTATGTACCGTCCAACTCTCGAGAGTTGGACGGTACATAGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003581.2-760s1c1
Sequence:CCGGCGACCGCATCTACGACCTCAACTCGAGTTGAGGTCGTAGATGCGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003581.2-1453s1c1
Sequence:CCGGCGTGGACAATGTCTACTGCATCTCGAGATGCAGTAGACATTGTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003581.2-788s1c1
Sequence:CCGGGCCTTCGTCAAGTTCGCCTATCTCGAGATAGGCGAACTTGACGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003581
NCK2 MISSION shRNA shRNA Plasmid DNA
NCK adaptor protein 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434745    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003581.2-2059s21c1
Sequence:CCGGATACGTTTGCTGATAGCAATACTCGAGTATTGCTATCAGCAAACGTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003581.2-1398s21c1
Sequence:CCGGACTTCTCCGTGTCCCTTAAAGCTCGAGCTTTAAGGGACACGGAGAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122914    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003581.2-2264s1c1
Sequence:CCGGGCTTGTTTGAATCTCACAATTCTCGAGAATTGTGAGATTCAAACAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003581.2-585s1c1
Sequence:CCGGCGGGCTATGTACCGTCCAACTCTCGAGAGTTGGACGGTACATAGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003581.2-760s1c1
Sequence:CCGGCGACCGCATCTACGACCTCAACTCGAGTTGAGGTCGTAGATGCGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003581.2-1453s1c1
Sequence:CCGGCGTGGACAATGTCTACTGCATCTCGAGATGCAGTAGACATTGTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003581.2-788s1c1
Sequence:CCGGGCCTTCGTCAAGTTCGCCTATCTCGAGATAGGCGAACTTGACGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003581
NCK2 MISSION shRNA Lentiviral Transduction Particles
NCK adaptor protein 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434745    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003581.2-2059s21c1
Sequence:CCGGATACGTTTGCTGATAGCAATACTCGAGTATTGCTATCAGCAAACGTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003581.2-1398s21c1
Sequence:CCGGACTTCTCCGTGTCCCTTAAAGCTCGAGCTTTAAGGGACACGGAGAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122914    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003581.2-2264s1c1
Sequence:CCGGGCTTGTTTGAATCTCACAATTCTCGAGAATTGTGAGATTCAAACAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003581.2-585s1c1
Sequence:CCGGCGGGCTATGTACCGTCCAACTCTCGAGAGTTGGACGGTACATAGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003581.2-760s1c1
Sequence:CCGGCGACCGCATCTACGACCTCAACTCGAGTTGAGGTCGTAGATGCGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003581.2-1453s1c1
Sequence:CCGGCGTGGACAATGTCTACTGCATCTCGAGATGCAGTAGACATTGTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003581.2-788s1c1
Sequence:CCGGGCCTTCGTCAAGTTCGCCTATCTCGAGATAGGCGAACTTGACGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010879
NCK2 MISSION shRNA Bacterial Glycerol Stock
NCK adaptor protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097164    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010879.2-1951s1c1
Sequence:CCGGCGAGGCTGTATGTAGTGAATACTCGAGTATTCACTACATACAGCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010879.2-1437s1c1
Sequence:CCGGAGGGAGAAACAAGCACTTCAACTCGAGTTGAAGTGCTTGTTTCTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010879.2-1126s1c1
Sequence:CCGGGTGATTGAGAAGCCGGAGAATCTCGAGATTCTCCGGCTTCTCAATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010879.2-777s1c1
Sequence:CCGGCCGCATCTATGACCTCAACATCTCGAGATGTTGAGGTCATAGATGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010879.2-1149s1c1
Sequence:CCGGCCCTGAATGGTGGAAATGCAACTCGAGTTGCATTTCCACCATTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010879
NCK2 MISSION shRNA shRNA Plasmid DNA
NCK adaptor protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097164    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010879.2-1951s1c1
Sequence:CCGGCGAGGCTGTATGTAGTGAATACTCGAGTATTCACTACATACAGCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010879.2-1437s1c1
Sequence:CCGGAGGGAGAAACAAGCACTTCAACTCGAGTTGAAGTGCTTGTTTCTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010879.2-1126s1c1
Sequence:CCGGGTGATTGAGAAGCCGGAGAATCTCGAGATTCTCCGGCTTCTCAATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010879.2-777s1c1
Sequence:CCGGCCGCATCTATGACCTCAACATCTCGAGATGTTGAGGTCATAGATGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010879.2-1149s1c1
Sequence:CCGGCCCTGAATGGTGGAAATGCAACTCGAGTTGCATTTCCACCATTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010879
NCK2 MISSION shRNA Lentiviral Transduction Particles
NCK adaptor protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097164    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010879.2-1951s1c1
Sequence:CCGGCGAGGCTGTATGTAGTGAATACTCGAGTATTCACTACATACAGCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010879.2-1437s1c1
Sequence:CCGGAGGGAGAAACAAGCACTTCAACTCGAGTTGAAGTGCTTGTTTCTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010879.2-1126s1c1
Sequence:CCGGGTGATTGAGAAGCCGGAGAATCTCGAGATTCTCCGGCTTCTCAATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010879.2-777s1c1
Sequence:CCGGCCGCATCTATGACCTCAACATCTCGAGATGTTGAGGTCATAGATGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010879.2-1149s1c1
Sequence:CCGGCCCTGAATGGTGGAAATGCAACTCGAGTTGCATTTCCACCATTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)