EMAIL THIS PAGE TO A FRIEND

NCKAP1

NCK-associated protein 1

119 Gene Product Result for
Synonyms: HEM2 NAP1 NAP125 p125Nap1
UniProtKB ID: Q9Y2A7, O60329, Q53QN5, Q53S94, Q53Y35
Gene ID:
Mouse(50884) NCK-associated protein 1
Rat(58823) NCK-associated protein 1
Zebrafish(561894) NCK-associated protein 1
chicken(424000) NCK-associated protein 1
cow(100300817) NCK-associated protein 1
Horse(100068260) NCK-associated protein 1
domestic cat(101096827) NCK-associated protein 1
dog(478828) NCK-associated protein 1
sheep(101122674) NCK-associated protein 1
domestic guinea pig(100715838) NCK-associated protein 1
Domestic Rabbit(100337891) NCK-associated protein 1
naked mole-rat(101714623) NCK-associated protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013436 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013436 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013436 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016965 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016965 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016965 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013436 Rosetta Predictions human pricing
NM_205842 Rosetta Predictions human pricing
NM_031618 Rosetta Predictions rat pricing
NM_016965 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013436 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091075 predicted 833
2 SASI_Hs01_00091076 predicted 2753
3 SASI_Hs01_00091078 predicted 1858
4 SASI_Hs01_00091079 predicted 3541
5 SASI_Hs01_00091080 predicted 2924
6 SASI_Hs01_00091081 predicted 1343
7 SASI_Hs01_00091082 predicted 1582
8 SASI_Hs01_00091083 predicted 3752
9 SASI_Hs02_00344836 predicted 3159
10 SASI_Hs02_00344837 predicted 3460
11 SASI_Hs01_00091077 predicted 1638
12 SASI_Hs01_00091084 predicted 3741
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_205842 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209980 predicted 843
2 SASI_Hs01_00209981 predicted 2771
3 SASI_Hs01_00209983 predicted 1878
4 SASI_Hs01_00209984 predicted 3560
5 SASI_Hs01_00209985 predicted 2941
6 SASI_Hs01_00209986 predicted 1364
7 SASI_Hs01_00209987 predicted 1599
8 SASI_Hs01_00209988 predicted 3774
9 SASI_Hs02_00373470 predicted 3178
10 SASI_Hs02_00373471 predicted 3473
11 SASI_Hs01_00209982 predicted 1663
12 SASI_Hs01_00209989 predicted 3768
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031618 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264912 predicted 1539
2 SASI_Rn02_00264913 predicted 2626
3 SASI_Rn02_00264914 predicted 2351
4 SASI_Rn02_00264915 predicted 638
5 SASI_Rn02_00264916 predicted 3130
6 SASI_Rn02_00264917 predicted 1402
7 SASI_Rn02_00264918 predicted 2229
8 SASI_Rn02_00264919 predicted 2495
9 SASI_Rn02_00264920 predicted 2945
10 SASI_Rn02_00264921 predicted 527
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016965 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102184 predicted 1864
2 SASI_Mm01_00102185 predicted 2840
3 SASI_Mm01_00102186 predicted 1825
4 SASI_Mm01_00102187 predicted 1274
5 SASI_Mm02_00323816 predicted 2134
6 SASI_Mm01_00102188 predicted 2260
7 SASI_Mm01_00102189 predicted 1205
8 SASI_Mm01_00102190 predicted 2553
9 SASI_Mm01_00102191 predicted 390
10 SASI_Mm02_00323817 predicted 2477
11 SASI_Mm01_00102192 predicted 2397
12 SASI_Mm01_00102193 predicted 2530
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013436
VALIDATED
NCKAP1 MISSION shRNA Bacterial Glycerol Stock
NCK-associated protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013436.3-1416s21c1
Sequence:CCGGGCACAGAGAAAGACGCAAGTTCTCGAGAACTTGCGTCTTTCTCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013436.3-1136s21c1
Sequence:CCGGCCGACACTATGCCTTGTGAATCTCGAGATTCACAAGGCATAGTGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013436.3-2081s21c1
Sequence:CCGGCCTCTCAATCAAGATACTCAACTCGAGTTGAGTATCTTGATTGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013436.3-1680s1c1
Sequence:CCGGGCAGAGGTATTACGTGCAGTACTCGAGTACTGCACGTAATACCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013436.3-1136s1c1
Sequence:CCGGCCGACACTATGCCTTGTGAATCTCGAGATTCACAAGGCATAGTGTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013436.3-1680s21c1
Sequence:CCGGGCAGAGGTATTACGTGCAGTACTCGAGTACTGCACGTAATACCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013436.3-1416s1c1
Sequence:CCGGGCACAGAGAAAGACGCAAGTTCTCGAGAACTTGCGTCTTTCTCTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013436.3-3565s1c1
Sequence:CCGGCTTAAAGAATTTCTGGCGCTTCTCGAGAAGCGCCAGAAATTCTTTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_013436.3-2081s1c1
Sequence:CCGGCCTCTCAATCAAGATACTCAACTCGAGTTGAGTATCTTGATTGAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013436
VALIDATED
NCKAP1 MISSION shRNA shRNA Plasmid DNA
NCK-associated protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013436.3-1416s21c1
Sequence:CCGGGCACAGAGAAAGACGCAAGTTCTCGAGAACTTGCGTCTTTCTCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013436.3-1136s21c1
Sequence:CCGGCCGACACTATGCCTTGTGAATCTCGAGATTCACAAGGCATAGTGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013436.3-2081s21c1
Sequence:CCGGCCTCTCAATCAAGATACTCAACTCGAGTTGAGTATCTTGATTGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013436.3-1680s1c1
Sequence:CCGGGCAGAGGTATTACGTGCAGTACTCGAGTACTGCACGTAATACCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013436.3-1136s1c1
Sequence:CCGGCCGACACTATGCCTTGTGAATCTCGAGATTCACAAGGCATAGTGTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013436.3-1680s21c1
Sequence:CCGGGCAGAGGTATTACGTGCAGTACTCGAGTACTGCACGTAATACCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013436.3-1416s1c1
Sequence:CCGGGCACAGAGAAAGACGCAAGTTCTCGAGAACTTGCGTCTTTCTCTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013436.3-3565s1c1
Sequence:CCGGCTTAAAGAATTTCTGGCGCTTCTCGAGAAGCGCCAGAAATTCTTTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_013436.3-2081s1c1
Sequence:CCGGCCTCTCAATCAAGATACTCAACTCGAGTTGAGTATCTTGATTGAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013436
VALIDATED
NCKAP1 MISSION shRNA Lentiviral Transduction Particles
NCK-associated protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013436.3-1416s21c1
Sequence:CCGGGCACAGAGAAAGACGCAAGTTCTCGAGAACTTGCGTCTTTCTCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013436.3-1136s21c1
Sequence:CCGGCCGACACTATGCCTTGTGAATCTCGAGATTCACAAGGCATAGTGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013436.3-2081s21c1
Sequence:CCGGCCTCTCAATCAAGATACTCAACTCGAGTTGAGTATCTTGATTGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013436.3-1680s1c1
Sequence:CCGGGCAGAGGTATTACGTGCAGTACTCGAGTACTGCACGTAATACCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013436.3-1136s1c1
Sequence:CCGGCCGACACTATGCCTTGTGAATCTCGAGATTCACAAGGCATAGTGTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013436.3-1680s21c1
Sequence:CCGGGCAGAGGTATTACGTGCAGTACTCGAGTACTGCACGTAATACCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013436.3-1416s1c1
Sequence:CCGGGCACAGAGAAAGACGCAAGTTCTCGAGAACTTGCGTCTTTCTCTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013436.3-3565s1c1
Sequence:CCGGCTTAAAGAATTTCTGGCGCTTCTCGAGAAGCGCCAGAAATTCTTTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_013436.3-2081s1c1
Sequence:CCGGCCTCTCAATCAAGATACTCAACTCGAGTTGAGTATCTTGATTGAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016965
VALIDATED
NCKAP1 MISSION shRNA Bacterial Glycerol Stock
NCK-associated protein 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000326995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016965.2-1763s21c1
Sequence:CCGGGCCATCATATAGGAGATCGTACTCGAGTACGATCTCCTATATGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016965.2-1831s21c1
Sequence:CCGGCGAAATCTCATCACCGATATTCTCGAGAATATCGGTGATGAGATTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016965.2-133s21c1
Sequence:CCGGCCCTCCTACCTTATTGACAAACTCGAGTTTGTCAATAAGGTAGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016965.1-133s1c1
Sequence:CCGGCCCTCCTACCTTATTGACAAACTCGAGTTTGTCAATAAGGTAGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016965.1-1763s1c1
Sequence:CCGGGCCATCATATAGGAGATCGTACTCGAGTACGATCTCCTATATGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016965.1-1831s1c1
Sequence:CCGGCGAAATCTCATCACCGATATTCTCGAGAATATCGGTGATGAGATTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016965.1-2818s1c1
Sequence:CCGGGAAGATTTCAAGGATCACATTCTCGAGAATGTGATCCTTGAAATCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016965.1-1828s1c1
Sequence:CCGGGCTCGAAATCTCATCACCGATCTCGAGATCGGTGATGAGATTTCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016965.2-2818s21c1
Sequence:CCGGGAAGATTTCAAGGATCACATTCTCGAGAATGTGATCCTTGAAATCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016965
VALIDATED
NCKAP1 MISSION shRNA shRNA Plasmid DNA
NCK-associated protein 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000326995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016965.2-1763s21c1
Sequence:CCGGGCCATCATATAGGAGATCGTACTCGAGTACGATCTCCTATATGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016965.2-1831s21c1
Sequence:CCGGCGAAATCTCATCACCGATATTCTCGAGAATATCGGTGATGAGATTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016965.2-133s21c1
Sequence:CCGGCCCTCCTACCTTATTGACAAACTCGAGTTTGTCAATAAGGTAGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016965.1-133s1c1
Sequence:CCGGCCCTCCTACCTTATTGACAAACTCGAGTTTGTCAATAAGGTAGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016965.1-1763s1c1
Sequence:CCGGGCCATCATATAGGAGATCGTACTCGAGTACGATCTCCTATATGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016965.1-1831s1c1
Sequence:CCGGCGAAATCTCATCACCGATATTCTCGAGAATATCGGTGATGAGATTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016965.1-2818s1c1
Sequence:CCGGGAAGATTTCAAGGATCACATTCTCGAGAATGTGATCCTTGAAATCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016965.1-1828s1c1
Sequence:CCGGGCTCGAAATCTCATCACCGATCTCGAGATCGGTGATGAGATTTCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016965.2-2818s21c1
Sequence:CCGGGAAGATTTCAAGGATCACATTCTCGAGAATGTGATCCTTGAAATCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016965
VALIDATED
NCKAP1 MISSION shRNA Lentiviral Transduction Particles
NCK-associated protein 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000326995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016965.2-1763s21c1
Sequence:CCGGGCCATCATATAGGAGATCGTACTCGAGTACGATCTCCTATATGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016965.2-1831s21c1
Sequence:CCGGCGAAATCTCATCACCGATATTCTCGAGAATATCGGTGATGAGATTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016965.2-133s21c1
Sequence:CCGGCCCTCCTACCTTATTGACAAACTCGAGTTTGTCAATAAGGTAGGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016965.1-133s1c1
Sequence:CCGGCCCTCCTACCTTATTGACAAACTCGAGTTTGTCAATAAGGTAGGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016965.1-1763s1c1
Sequence:CCGGGCCATCATATAGGAGATCGTACTCGAGTACGATCTCCTATATGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016965.1-1831s1c1
Sequence:CCGGCGAAATCTCATCACCGATATTCTCGAGAATATCGGTGATGAGATTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016965.1-2818s1c1
Sequence:CCGGGAAGATTTCAAGGATCACATTCTCGAGAATGTGATCCTTGAAATCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016965.1-1828s1c1
Sequence:CCGGGCTCGAAATCTCATCACCGATCTCGAGATCGGTGATGAGATTTCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016965.2-2818s21c1
Sequence:CCGGGAAGATTTCAAGGATCACATTCTCGAGAATGTGATCCTTGAAATCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)