EMAIL THIS PAGE TO A FRIEND

NCKAP1L

NCK-associated protein 1-like

77 Gene Product Result for
Synonyms: HEM1
UniProtKB ID: P55160, B4DUT5, Q52LW0
Gene ID:
Human(3071) Summary: This gene encodes a member of the HEM family of tissue-specific transmembrane proteins which are highly conserved from invertebrates through mammals. This gene is only expressed in hematopoietic cells. The encoded protein is a part of the Scar/WAVE complex which plays an important role in regulating cell shape in both metazoans and plants. Alternatively spliced transcript variants encoding different isoforms have been found.[provided by RefSeq, May 2010]
Mouse(105855) NCK associated protein 1 like
Rat(315348) NCK associated protein 1 like
naked mole-rat(101716508) NCK-associated protein 1-like
Domestic Rabbit(100340824) NCK-associated protein 1-like
domestic guinea pig(100722923) NCK-associated protein 1-like
sheep(101119198) NCK-associated protein 1-like
chicken(425499) NCK-associated protein 1-like
dog(486492) NCK-associated protein 1-like
cow(513641) NCK-associated protein 1-like
Horse(100062541) NCK-associated protein 1-like
domestic cat(101094357) NCK-associated protein 1-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153505 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153505 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153505 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005337 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005337 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005337 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005337 Rosetta Predictions human pricing
NM_001108119 Rosetta Predictions rat pricing
NM_153505 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005337 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203024 predicted 524
2 SASI_Hs01_00203025 predicted 464
3 SASI_Hs01_00203026 predicted 833
4 SASI_Hs01_00203027 predicted 2438
5 SASI_Hs01_00203028 predicted 2894
6 SASI_Hs01_00203029 predicted 371
7 SASI_Hs01_00203030 predicted 3399
8 SASI_Hs01_00203031 predicted 2716
9 SASI_Hs02_00339407 predicted 1551
10 SASI_Hs01_00203033 predicted 1744
11 SASI_Hs01_00203032 predicted 2391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108119 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235544 predicted 440
2 SASI_Rn02_00235545 predicted 1949
3 SASI_Rn02_00235546 predicted 2391
4 SASI_Rn02_00235547 predicted 1531
5 SASI_Rn02_00235548 predicted 743
6 SASI_Rn02_00235549 predicted 212
7 SASI_Rn02_00235550 predicted 331
8 SASI_Rn02_00235551 predicted 1864
9 SASI_Rn02_00235552 predicted 767
10 SASI_Rn02_00235553 predicted 3319
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153505 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101916 predicted 795
2 SASI_Mm01_00101917 predicted 777
3 SASI_Mm01_00101918 predicted 761
4 SASI_Mm02_00343246 predicted 3479
5 SASI_Mm02_00343247 predicted 352
6 SASI_Mm01_00101919 predicted 2098
7 SASI_Mm01_00101920 predicted 1879
8 SASI_Mm01_00101921 predicted 3028
9 SASI_Mm01_00101922 predicted 495
10 SASI_Mm01_00101923 predicted 2203
11 SASI_Mm01_00101924 predicted 1055
12 SASI_Mm01_00101925 predicted 321
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153505
NCKAP1L MISSION shRNA Bacterial Glycerol Stock
NCK-associated protein 1-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153505.2-764s1c1
Sequence:CCGGGCCATGATTAACCCTGCTAATCTCGAGATTAGCAGGGTTAATCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153505.2-2342s1c1
Sequence:CCGGGCTTCCAGAATCGTTCGCAATCTCGAGATTGCGAACGATTCTGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153505.2-246s1c1
Sequence:CCGGCCAACATAGATGTCCGAAATACTCGAGTATTTCGGACATCTATGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153505.2-765s1c1
Sequence:CCGGCCATGATTAACCCTGCTAATTCTCGAGAATTAGCAGGGTTAATCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112250    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153505.2-3494s1c1
Sequence:CCGGGCAGTGAAAGTTGCAGCCATTCTCGAGAATGGCTGCAACTTTCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153505
NCKAP1L MISSION shRNA shRNA Plasmid DNA
NCK-associated protein 1-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153505.2-764s1c1
Sequence:CCGGGCCATGATTAACCCTGCTAATCTCGAGATTAGCAGGGTTAATCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153505.2-2342s1c1
Sequence:CCGGGCTTCCAGAATCGTTCGCAATCTCGAGATTGCGAACGATTCTGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153505.2-246s1c1
Sequence:CCGGCCAACATAGATGTCCGAAATACTCGAGTATTTCGGACATCTATGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153505.2-765s1c1
Sequence:CCGGCCATGATTAACCCTGCTAATTCTCGAGAATTAGCAGGGTTAATCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112250    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153505.2-3494s1c1
Sequence:CCGGGCAGTGAAAGTTGCAGCCATTCTCGAGAATGGCTGCAACTTTCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153505
NCKAP1L MISSION shRNA Lentiviral Transduction Particles
NCK-associated protein 1-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153505.2-764s1c1
Sequence:CCGGGCCATGATTAACCCTGCTAATCTCGAGATTAGCAGGGTTAATCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153505.2-2342s1c1
Sequence:CCGGGCTTCCAGAATCGTTCGCAATCTCGAGATTGCGAACGATTCTGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153505.2-246s1c1
Sequence:CCGGCCAACATAGATGTCCGAAATACTCGAGTATTTCGGACATCTATGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153505.2-765s1c1
Sequence:CCGGCCATGATTAACCCTGCTAATTCTCGAGAATTAGCAGGGTTAATCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112250    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153505.2-3494s1c1
Sequence:CCGGGCAGTGAAAGTTGCAGCCATTCTCGAGAATGGCTGCAACTTTCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005337
NCKAP1L MISSION shRNA Bacterial Glycerol Stock
NCK-associated protein 1-like
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005337.2-1315s1c1
Sequence:CCGGCCGAAGACACATCAAAGTGATCTCGAGATCACTTTGATGTGTCTTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005337.2-3645s1c1
Sequence:CCGGCATGGAGGACAGCTTATGGAACTCGAGTTCCATAAGCTGTCCTCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005337.2-514s1c1
Sequence:CCGGGCGGATACTCATTGGCATGTACTCGAGTACATGCCAATGAGTATCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005337.2-2861s1c1
Sequence:CCGGCCATTTCTTATGGGTCCCATTCTCGAGAATGGGACCCATAAGAAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005337.2-3609s1c1
Sequence:CCGGGCTGAGAAATCGTAGAGCAGTCTCGAGACTGCTCTACGATTTCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005337.2-1595s1c1
Sequence:CCGGGCCAAGGTGATGAACCTCATTCTCGAGAATGAGGTTCATCACCTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005337.2-262s1c1
Sequence:CCGGCCGAAACAGCACGCAACATTTCTCGAGAAATGTTGCGTGCTGTTTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005337.2-3583s1c1
Sequence:CCGGGCAGATCTGTGGAAGAACAATCTCGAGATTGTTCTTCCACAGATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005337.2-767s1c1
Sequence:CCGGGCCATGATTAACCCTGCTAATCTCGAGATTAGCAGGGTTAATCATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005337
NCKAP1L MISSION shRNA shRNA Plasmid DNA
NCK-associated protein 1-like
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005337.2-1315s1c1
Sequence:CCGGCCGAAGACACATCAAAGTGATCTCGAGATCACTTTGATGTGTCTTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005337.2-3645s1c1
Sequence:CCGGCATGGAGGACAGCTTATGGAACTCGAGTTCCATAAGCTGTCCTCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005337.2-514s1c1
Sequence:CCGGGCGGATACTCATTGGCATGTACTCGAGTACATGCCAATGAGTATCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005337.2-2861s1c1
Sequence:CCGGCCATTTCTTATGGGTCCCATTCTCGAGAATGGGACCCATAAGAAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005337.2-3609s1c1
Sequence:CCGGGCTGAGAAATCGTAGAGCAGTCTCGAGACTGCTCTACGATTTCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005337.2-1595s1c1
Sequence:CCGGGCCAAGGTGATGAACCTCATTCTCGAGAATGAGGTTCATCACCTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005337.2-262s1c1
Sequence:CCGGCCGAAACAGCACGCAACATTTCTCGAGAAATGTTGCGTGCTGTTTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005337.2-3583s1c1
Sequence:CCGGGCAGATCTGTGGAAGAACAATCTCGAGATTGTTCTTCCACAGATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005337.2-767s1c1
Sequence:CCGGGCCATGATTAACCCTGCTAATCTCGAGATTAGCAGGGTTAATCATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005337
NCKAP1L MISSION shRNA Lentiviral Transduction Particles
NCK-associated protein 1-like
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005337.2-1315s1c1
Sequence:CCGGCCGAAGACACATCAAAGTGATCTCGAGATCACTTTGATGTGTCTTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005337.2-3645s1c1
Sequence:CCGGCATGGAGGACAGCTTATGGAACTCGAGTTCCATAAGCTGTCCTCCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005337.2-514s1c1
Sequence:CCGGGCGGATACTCATTGGCATGTACTCGAGTACATGCCAATGAGTATCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005337.2-2861s1c1
Sequence:CCGGCCATTTCTTATGGGTCCCATTCTCGAGAATGGGACCCATAAGAAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005337.2-3609s1c1
Sequence:CCGGGCTGAGAAATCGTAGAGCAGTCTCGAGACTGCTCTACGATTTCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005337.2-1595s1c1
Sequence:CCGGGCCAAGGTGATGAACCTCATTCTCGAGAATGAGGTTCATCACCTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005337.2-262s1c1
Sequence:CCGGCCGAAACAGCACGCAACATTTCTCGAGAAATGTTGCGTGCTGTTTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005337.2-3583s1c1
Sequence:CCGGGCAGATCTGTGGAAGAACAATCTCGAGATTGTTCTTCCACAGATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005337.2-767s1c1
Sequence:CCGGGCCATGATTAACCCTGCTAATCTCGAGATTAGCAGGGTTAATCATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)