EMAIL THIS PAGE TO A FRIEND

NCKAP5

NCK-associated protein 5

208 Gene Product Result for
Synonyms: ERIH1 ERIH2 NAP5
Gene ID:
Mouse(210356) NCK-associated protein 5
Rat(363974) NCK-associated protein 5
chicken(424283) NCK-associated protein 5
cow(786958) NCK-associated protein 5
Horse(100054280) NCK-associated protein 5
domestic cat(101088424) NCK-associated protein 5
dog(483893) NCK-associated protein 5
sheep(101116712) NCK-associated protein 5
domestic guinea pig(100713151) NCK-associated protein 5
Domestic Rabbit(100349145) NCK-associated protein 5
naked mole-rat(101720700) NCK-associated protein 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207481 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207481 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207481 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_176957 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176957 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176957 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_172484 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172484 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172484 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU221561 MISSION® esiRNA esiRNA targeting human NCKAP5 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207363 Rosetta Predictions human pricing
NM_207481 Rosetta Predictions human pricing
XM_929894 Rosetta Predictions human pricing
XM_001056226 Rosetta Predictions rat pricing
XM_344134 Rosetta Predictions rat pricing
NM_001081756 Rosetta Predictions mouse pricing
NM_172484 Rosetta Predictions mouse pricing
NM_176957 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207363 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373937 predicted 1070
2 SASI_Hs02_00373938 predicted 5793
3 SASI_Hs02_00373939 predicted 1120
4 SASI_Hs02_00373940 predicted 377
5 SASI_Hs02_00373941 predicted 1018
6 SASI_Hs02_00373942 predicted 1129
7 SASI_Hs02_00373943 predicted 721
8 SASI_Hs02_00373944 predicted 586
9 SASI_Hs02_00373945 predicted 6013
10 SASI_Hs02_00373946 predicted 1056
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207481 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00374105 predicted 1064
2 SASI_Hs02_00374106 predicted 1842
3 SASI_Hs02_00374107 predicted 1119
4 SASI_Hs01_00038744 predicted 377
5 SASI_Hs02_00374108 predicted 1018
6 SASI_Hs02_00374109 predicted 1131
7 SASI_Hs01_00038745 predicted 728
8 SASI_Hs01_00038747 predicted 586
9 SASI_Hs02_00374110 predicted 2057
10 SASI_Hs02_00374111 predicted 1064
11 SASI_Hs01_00038743 predicted 544
12 SASI_Hs01_00038746 predicted 445
13 SASI_Hs01_00038748 predicted 720
14 SASI_Hs01_00038749 predicted 677
15 SASI_Hs01_00038750 predicted 732
16 SASI_Hs01_00038751 predicted 531
17 SASI_Hs01_00038752 predicted 424
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_929894 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00271969 predicted 1625
2 SASI_Hs01_00271970 predicted 1679
3 SASI_Hs01_00271971 predicted 1687
4 SASI_Hs01_00271972 predicted 1701
5 SASI_Hs01_00271973 predicted 1493
6 SASI_Hs01_00271974 predicted 1687
7 SASI_Hs01_00271975 predicted 1471
8 SASI_Hs01_00271976 predicted 1550
9 SASI_Hs01_00271977 predicted 1466
10 SASI_Hs01_00271978 predicted 1543
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056226 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00282518 predicted 3692
2 SASI_Rn02_00282519 predicted 565
3 SASI_Rn02_00282520 predicted 3435
4 SASI_Rn02_00282521 predicted 2341
5 SASI_Rn02_00282522 predicted 2094
6 SASI_Rn02_00282523 predicted 1307
7 SASI_Rn02_00282524 predicted 4910
8 SASI_Rn02_00282525 predicted 4020
9 SASI_Rn02_00282526 predicted 2077
10 SASI_Rn02_00282527 predicted 1230
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344134 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396846 predicted 3791
2 SASI_Rn02_00396847 predicted 842
3 SASI_Rn02_00396848 predicted 3533
4 SASI_Rn02_00396849 predicted 2428
5 SASI_Rn02_00396850 predicted 2184
6 SASI_Rn02_00396851 predicted 1400
7 SASI_Rn02_00396852 predicted 5004
8 SASI_Rn02_00396853 predicted 4113
9 SASI_Rn02_00396854 predicted 2162
10 SASI_Rn02_00396855 predicted 1317
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081756 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299053 predicted 6097
2 SASI_Mm02_00299054 predicted 6590
3 SASI_Mm02_00299055 predicted 782
4 SASI_Mm02_00299056 predicted 6560
5 SASI_Mm02_00299057 predicted 811
6 SASI_Mm02_00299058 predicted 6580
7 SASI_Mm02_00299059 predicted 804
8 SASI_Mm02_00299060 predicted 868
9 SASI_Mm02_00299061 predicted 797
10 SASI_Mm02_00299062 predicted 826
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172484 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344042 predicted 5961
2 SASI_Mm02_00344043 predicted 6452
3 SASI_Mm02_00344044 predicted 637
4 SASI_Mm02_00344045 predicted 6418
5 SASI_Mm02_00344046 predicted 669
6 SASI_Mm02_00344047 predicted 6441
7 SASI_Mm02_00344048 predicted 666
8 SASI_Mm02_00344049 predicted 733
9 SASI_Mm02_00344050 predicted 662
10 SASI_Mm02_00344051 predicted 691
11 SASI_Mm01_00062765 predicted 2423
12 SASI_Mm01_00062766 predicted 2668
13 SASI_Mm01_00062767 predicted 2962
14 SASI_Mm01_00062768 predicted 897
15 SASI_Mm01_00062769 predicted 4435
16 SASI_Mm01_00062770 predicted 1641
17 SASI_Mm01_00062771 predicted 1391
18 SASI_Mm01_00062772 predicted 1463
19 SASI_Mm01_00062773 predicted 3760
20 SASI_Mm01_00062774 predicted 1377
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176957 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346850 predicted 875
2 SASI_Mm02_00346851 predicted 713
3 SASI_Mm02_00346852 predicted 1489
4 SASI_Mm02_00346853 predicted 1225
5 SASI_Mm02_00346854 predicted 1026
6 SASI_Mm02_00346855 predicted 1258
7 SASI_Mm02_00346856 predicted 1010
8 SASI_Mm02_00346857 predicted 584
9 SASI_Mm02_00346858 predicted 1613
10 SASI_Mm02_00346859 predicted 982
11 SASI_Mm01_00075863 predicted 1179
12 SASI_Mm01_00075864 predicted 705
13 SASI_Mm01_00075865 predicted 704
14 SASI_Mm01_00075866 predicted 1276
15 SASI_Mm01_00075867 predicted 511
16 SASI_Mm01_00075868 predicted 1289
17 SASI_Mm01_00075869 predicted 587
18 SASI_Mm01_00075870 predicted 1176
19 SASI_Mm01_00075871 predicted 474
20 SASI_Mm01_00075872 predicted 1147
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207481
NCKAP5 MISSION shRNA Bacterial Glycerol Stock
NCK-associated protein 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207481.1-391s1c1
Sequence:CCGGGATGGAAGAAACAGTACGAAACTCGAGTTTCGTACTGTTTCTTCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207481.1-1010s1c1
Sequence:CCGGCCTACCTTACTTTGTCACATTCTCGAGAATGTGACAAAGTAAGGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207481.1-521s1c1
Sequence:CCGGGAAGATCTTCACATGGTGGTTCTCGAGAACCACCATGTGAAGATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141554    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207481.1-221s1c1
Sequence:CCGGCGAGAAGTTGCCCAAAGAACACTCGAGTGTTCTTTGGGCAACTTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207481.1-565s1c1
Sequence:CCGGCAGCAGTACAGATGAGGGAAACTCGAGTTTCCCTCATCTGTACTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143397    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207481.1-524s1c1
Sequence:CCGGGATCTTCACATGGTGGTTGATCTCGAGATCAACCACCATGTGAAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207481.1-542s1c1
Sequence:CCGGGATGAGGATTCGAGGAGTGAACTCGAGTTCACTCCTCGAATCCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207481.1-284s1c1
Sequence:CCGGGAGGAGAGACACTTACGTCTTCTCGAGAAGACGTAAGTGTCTCTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207481
NCKAP5 MISSION shRNA shRNA Plasmid DNA
NCK-associated protein 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207481.1-391s1c1
Sequence:CCGGGATGGAAGAAACAGTACGAAACTCGAGTTTCGTACTGTTTCTTCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207481.1-1010s1c1
Sequence:CCGGCCTACCTTACTTTGTCACATTCTCGAGAATGTGACAAAGTAAGGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207481.1-521s1c1
Sequence:CCGGGAAGATCTTCACATGGTGGTTCTCGAGAACCACCATGTGAAGATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141554    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207481.1-221s1c1
Sequence:CCGGCGAGAAGTTGCCCAAAGAACACTCGAGTGTTCTTTGGGCAACTTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207481.1-565s1c1
Sequence:CCGGCAGCAGTACAGATGAGGGAAACTCGAGTTTCCCTCATCTGTACTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143397    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207481.1-524s1c1
Sequence:CCGGGATCTTCACATGGTGGTTGATCTCGAGATCAACCACCATGTGAAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207481.1-542s1c1
Sequence:CCGGGATGAGGATTCGAGGAGTGAACTCGAGTTCACTCCTCGAATCCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207481.1-284s1c1
Sequence:CCGGGAGGAGAGACACTTACGTCTTCTCGAGAAGACGTAAGTGTCTCTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207481
NCKAP5 MISSION shRNA Lentiviral Transduction Particles
NCK-associated protein 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207481.1-391s1c1
Sequence:CCGGGATGGAAGAAACAGTACGAAACTCGAGTTTCGTACTGTTTCTTCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207481.1-1010s1c1
Sequence:CCGGCCTACCTTACTTTGTCACATTCTCGAGAATGTGACAAAGTAAGGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207481.1-521s1c1
Sequence:CCGGGAAGATCTTCACATGGTGGTTCTCGAGAACCACCATGTGAAGATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141554    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207481.1-221s1c1
Sequence:CCGGCGAGAAGTTGCCCAAAGAACACTCGAGTGTTCTTTGGGCAACTTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207481.1-565s1c1
Sequence:CCGGCAGCAGTACAGATGAGGGAAACTCGAGTTTCCCTCATCTGTACTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143397    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207481.1-524s1c1
Sequence:CCGGGATCTTCACATGGTGGTTGATCTCGAGATCAACCACCATGTGAAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207481.1-542s1c1
Sequence:CCGGGATGAGGATTCGAGGAGTGAACTCGAGTTCACTCCTCGAATCCTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207481.1-284s1c1
Sequence:CCGGGAGGAGAGACACTTACGTCTTCTCGAGAAGACGTAAGTGTCTCTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176957
NCKAP5 MISSION shRNA Bacterial Glycerol Stock
NCK-associated protein 5
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000178179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176957.2-691s1c1
Sequence:CCGGGAATATTCAGTGGCCAGAAATCTCGAGATTTCTGGCCACTGAATATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176957.2-987s1c1
Sequence:CCGGCGGCATGAAAGCAACAAATTACTCGAGTAATTTGTTGCTTTCATGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176957.2-800s1c1
Sequence:CCGGCTTCCCAGTATGTCAAGCTATCTCGAGATAGCTTGACATACTGGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176957.2-813s1c1
Sequence:CCGGCAAGCTATGCAGTGTTGCCATCTCGAGATGGCAACACTGCATAGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176957
NCKAP5 MISSION shRNA shRNA Plasmid DNA
NCK-associated protein 5
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000178179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176957.2-691s1c1
Sequence:CCGGGAATATTCAGTGGCCAGAAATCTCGAGATTTCTGGCCACTGAATATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176957.2-987s1c1
Sequence:CCGGCGGCATGAAAGCAACAAATTACTCGAGTAATTTGTTGCTTTCATGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176957.2-800s1c1
Sequence:CCGGCTTCCCAGTATGTCAAGCTATCTCGAGATAGCTTGACATACTGGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176957.2-813s1c1
Sequence:CCGGCAAGCTATGCAGTGTTGCCATCTCGAGATGGCAACACTGCATAGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176957
NCKAP5 MISSION shRNA Lentiviral Transduction Particles
NCK-associated protein 5
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000178179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176957.2-691s1c1
Sequence:CCGGGAATATTCAGTGGCCAGAAATCTCGAGATTTCTGGCCACTGAATATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176957.2-987s1c1
Sequence:CCGGCGGCATGAAAGCAACAAATTACTCGAGTAATTTGTTGCTTTCATGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176957.2-800s1c1
Sequence:CCGGCTTCCCAGTATGTCAAGCTATCTCGAGATAGCTTGACATACTGGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176957.2-813s1c1
Sequence:CCGGCAAGCTATGCAGTGTTGCCATCTCGAGATGGCAACACTGCATAGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172484
NCKAP5 MISSION shRNA Bacterial Glycerol Stock
NCK-associated protein 5
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000201986    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172484.2-6664s1c1
Sequence:CCGGCCTGGGTACTCTTTGCCATATCTCGAGATATGGCAAAGAGTACCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172484.2-5933s1c1
Sequence:CCGGCCTCTTGTGCAAGTCAAGCATCTCGAGATGCTTGACTTGCACAAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172484.2-1329s1c1
Sequence:CCGGCCGTATCAAAGAAAGCCACATCTCGAGATGTGGCTTTCTTTGATACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172484.2-1895s1c1
Sequence:CCGGCCGATGACAATGAGACCCTAACTCGAGTTAGGGTCTCATTGTCATCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172484
NCKAP5 MISSION shRNA shRNA Plasmid DNA
NCK-associated protein 5
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000201986    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172484.2-6664s1c1
Sequence:CCGGCCTGGGTACTCTTTGCCATATCTCGAGATATGGCAAAGAGTACCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172484.2-5933s1c1
Sequence:CCGGCCTCTTGTGCAAGTCAAGCATCTCGAGATGCTTGACTTGCACAAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172484.2-1329s1c1
Sequence:CCGGCCGTATCAAAGAAAGCCACATCTCGAGATGTGGCTTTCTTTGATACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172484.2-1895s1c1
Sequence:CCGGCCGATGACAATGAGACCCTAACTCGAGTTAGGGTCTCATTGTCATCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172484
NCKAP5 MISSION shRNA Lentiviral Transduction Particles
NCK-associated protein 5
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000201986    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172484.2-6664s1c1
Sequence:CCGGCCTGGGTACTCTTTGCCATATCTCGAGATATGGCAAAGAGTACCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172484.2-5933s1c1
Sequence:CCGGCCTCTTGTGCAAGTCAAGCATCTCGAGATGCTTGACTTGCACAAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172484.2-1329s1c1
Sequence:CCGGCCGTATCAAAGAAAGCCACATCTCGAGATGTGGCTTTCTTTGATACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172484.2-1895s1c1
Sequence:CCGGCCGATGACAATGAGACCCTAACTCGAGTTAGGGTCTCATTGTCATCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)