EMAIL THIS PAGE TO A FRIEND

NCKAP5L

NCK-associated protein 5-like

143 Gene Product Result for
Synonyms: KIAA1602
UniProtKB ID: Q9HCH0, Q2TB26, Q71RH1, Q8N4W1, Q96HX2
Gene ID:
Mouse(380969) NCK-associated protein 5-like
Rat(315297) NCK-associated protein 5-like
domestic cat(101092696) NCK-associated protein 5-like
cow(504364) NCK-associated protein 5-like
dog(486554) NCK-associated protein 5-like
naked mole-rat(101708503) NCK-associated protein 5-like
domestic guinea pig(100723016) NCK-associated protein 5-like
sheep(101122265) NCK-associated protein 5-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA041034 Anti-NCKAP5L antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001884 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001001884 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001001884 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001037806 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001037806 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001037806 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037806 Rosetta Predictions human pricing
NM_020941 Rosetta Predictions human pricing
XM_035497 Rosetta Predictions human pricing
XM_001063764 Rosetta Predictions rat pricing
XM_235649 Rosetta Predictions rat pricing
NM_001001884 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037806 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238435 predicted 1648
2 SASI_Hs01_00238436 predicted 1477
3 SASI_Hs01_00238437 predicted 1629
4 SASI_Hs01_00238439 predicted 1477
5 SASI_Hs01_00238440 predicted 1520
6 SASI_Hs01_00238442 predicted 1508
7 SASI_Hs01_00238443 predicted 1426
8 SASI_Hs02_00308371 predicted 1651
9 SASI_Hs02_00308372 predicted 1504
10 SASI_Hs02_00308373 predicted 1503
11 SASI_Hs01_00238438 predicted 1537
12 SASI_Hs01_00238441 predicted 1429
13 SASI_Hs01_00238444 predicted 1482
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020941 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354336 predicted 1560
2 SASI_Hs02_00354337 predicted 3419
3 SASI_Hs02_00354338 predicted 1881
4 SASI_Hs02_00354339 predicted 3841
5 SASI_Hs02_00354340 predicted 3354
6 SASI_Hs02_00354341 predicted 1205
7 SASI_Hs02_00354342 predicted 1882
8 SASI_Hs02_00354343 predicted 1859
9 SASI_Hs02_00354344 predicted 1861
10 SASI_Hs02_00354345 predicted 259
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_035497 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00286812 predicted 4240
2 SASI_Hs01_00286813 predicted 4166
3 SASI_Hs01_00286814 predicted 4255
4 SASI_Hs01_00286815 predicted 2917
5 SASI_Hs01_00286816 predicted 4000
6 SASI_Hs01_00286817 predicted 3990
7 SASI_Hs01_00286818 predicted 3995
8 SASI_Hs01_00286819 predicted 4131
9 SASI_Hs01_00286820 predicted 4142
10 SASI_Hs01_00286821 predicted 4140
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063764 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00308231 predicted 2589
2 SASI_Rn02_00308232 predicted 2035
3 SASI_Rn02_00308233 predicted 3192
4 SASI_Rn02_00308234 predicted 2684
5 SASI_Rn02_00308235 predicted 3102
6 SASI_Rn02_00308236 predicted 1618
7 SASI_Rn02_00308237 predicted 2323
8 SASI_Rn02_00308238 predicted 3090
9 SASI_Rn02_00308239 predicted 1617
10 SASI_Rn02_00308240 predicted 480
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235649 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389546 predicted 3132
2 SASI_Rn02_00389547 predicted 3040
3 SASI_Rn02_00389548 predicted 3015
4 SASI_Rn02_00389549 predicted 3293
5 SASI_Rn02_00389550 predicted 2894
6 SASI_Rn02_00389551 predicted 3027
7 SASI_Rn02_00389552 predicted 2866
8 SASI_Rn02_00389553 predicted 2862
9 SASI_Rn02_00389554 predicted 3283
10 SASI_Rn02_00389555 predicted 3616
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001884 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117327 predicted 2742
2 SASI_Mm01_00117329 predicted 3235
3 SASI_Mm01_00117330 predicted 4034
4 SASI_Mm01_00117331 predicted 3494
5 SASI_Mm01_00117332 predicted 3041
6 SASI_Mm01_00117333 predicted 446
7 SASI_Mm01_00117334 predicted 2272
8 SASI_Mm01_00117335 predicted 3336
9 SASI_Mm01_00117336 predicted 483
10 SASI_Mm02_00286230 predicted 2629
11 SASI_Mm01_00117328 predicted 1572
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001884
VALIDATED
NCKAP5L MISSION shRNA Bacterial Glycerol Stock
NCK-associated protein 5-like
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001884.1-1198s1c1
Sequence:CCGGCCTTGGAGACACAGAGACTTACTCGAGTAAGTCTCTGTGTCTCCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001884.1-3261s1c1
Sequence:CCGGCCTTCATGCAACAGCTACTGACTCGAGTCAGTAGCTGTTGCATGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001884.1-441s21c1
Sequence:CCGGTGCGGGAAGAGTGTATCAAACCTCGAGGTTTGATACACTCTTCCCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001884.1-756s21c1
Sequence:CCGGTTCGGAAGAAAGCTCAGATTTCTCGAGAAATCTGAGCTTTCTTCCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001001884.1-4137s21c1
Sequence:CCGGCCCTAAGTGACTCCCTCTATGCTCGAGCATAGAGGGAGTCACTTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001001884.1-2945s21c1
Sequence:CCGGGCCAGCTGGTTTGGCCTTAAACTCGAGTTTAAGGCCAAACCAGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001001884.1-4694s21c1
Sequence:CCGGGTTTGTCTGTCTTCATCTTTGCTCGAGCAAAGATGAAGACAGACAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001884
VALIDATED
NCKAP5L MISSION shRNA shRNA Plasmid DNA
NCK-associated protein 5-like
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001884.1-1198s1c1
Sequence:CCGGCCTTGGAGACACAGAGACTTACTCGAGTAAGTCTCTGTGTCTCCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001884.1-3261s1c1
Sequence:CCGGCCTTCATGCAACAGCTACTGACTCGAGTCAGTAGCTGTTGCATGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001884.1-441s21c1
Sequence:CCGGTGCGGGAAGAGTGTATCAAACCTCGAGGTTTGATACACTCTTCCCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001884.1-756s21c1
Sequence:CCGGTTCGGAAGAAAGCTCAGATTTCTCGAGAAATCTGAGCTTTCTTCCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001001884.1-4137s21c1
Sequence:CCGGCCCTAAGTGACTCCCTCTATGCTCGAGCATAGAGGGAGTCACTTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001001884.1-2945s21c1
Sequence:CCGGGCCAGCTGGTTTGGCCTTAAACTCGAGTTTAAGGCCAAACCAGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001001884.1-4694s21c1
Sequence:CCGGGTTTGTCTGTCTTCATCTTTGCTCGAGCAAAGATGAAGACAGACAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001884
VALIDATED
NCKAP5L MISSION shRNA Lentiviral Transduction Particles
NCK-associated protein 5-like
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001884.1-1198s1c1
Sequence:CCGGCCTTGGAGACACAGAGACTTACTCGAGTAAGTCTCTGTGTCTCCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001884.1-3261s1c1
Sequence:CCGGCCTTCATGCAACAGCTACTGACTCGAGTCAGTAGCTGTTGCATGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001884.1-441s21c1
Sequence:CCGGTGCGGGAAGAGTGTATCAAACCTCGAGGTTTGATACACTCTTCCCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001884.1-756s21c1
Sequence:CCGGTTCGGAAGAAAGCTCAGATTTCTCGAGAAATCTGAGCTTTCTTCCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001001884.1-4137s21c1
Sequence:CCGGCCCTAAGTGACTCCCTCTATGCTCGAGCATAGAGGGAGTCACTTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001001884.1-2945s21c1
Sequence:CCGGGCCAGCTGGTTTGGCCTTAAACTCGAGTTTAAGGCCAAACCAGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001001884.1-4694s21c1
Sequence:CCGGGTTTGTCTGTCTTCATCTTTGCTCGAGCAAAGATGAAGACAGACAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037806
VALIDATED
NCKAP5L MISSION shRNA Bacterial Glycerol Stock
NCK-associated protein 5-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037806.3-2413s21c1
Sequence:CCGGGCAGCAGGAACCTGGACTTATCTCGAGATAAGTCCAGGTTCCTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263346    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037806.3-4309s21c1
Sequence:CCGGACCAAGGAGGCAGGTGGATAACTCGAGTTATCCACCTGCCTCCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037806.3-3274s21c1
Sequence:CCGGCTTCATGCAGCAGCTGCTAAACTCGAGTTTAGCAGCTGCTGCATGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001037806.3-753s21c1
Sequence:CCGGTTCGGAAGAAGGCCCAGATTCCTCGAGGAATCTGGGCCTTCTTCCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037806.3-1860s21c1
Sequence:CCGGCTCCCTGCTATGAGAACATTCCTCGAGGAATGTTCTCATAGCAGGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037806
VALIDATED
NCKAP5L MISSION shRNA shRNA Plasmid DNA
NCK-associated protein 5-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037806.3-2413s21c1
Sequence:CCGGGCAGCAGGAACCTGGACTTATCTCGAGATAAGTCCAGGTTCCTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263346    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037806.3-4309s21c1
Sequence:CCGGACCAAGGAGGCAGGTGGATAACTCGAGTTATCCACCTGCCTCCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037806.3-3274s21c1
Sequence:CCGGCTTCATGCAGCAGCTGCTAAACTCGAGTTTAGCAGCTGCTGCATGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001037806.3-753s21c1
Sequence:CCGGTTCGGAAGAAGGCCCAGATTCCTCGAGGAATCTGGGCCTTCTTCCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037806.3-1860s21c1
Sequence:CCGGCTCCCTGCTATGAGAACATTCCTCGAGGAATGTTCTCATAGCAGGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037806
VALIDATED
NCKAP5L MISSION shRNA Lentiviral Transduction Particles
NCK-associated protein 5-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037806.3-2413s21c1
Sequence:CCGGGCAGCAGGAACCTGGACTTATCTCGAGATAAGTCCAGGTTCCTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263346    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037806.3-4309s21c1
Sequence:CCGGACCAAGGAGGCAGGTGGATAACTCGAGTTATCCACCTGCCTCCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037806.3-3274s21c1
Sequence:CCGGCTTCATGCAGCAGCTGCTAAACTCGAGTTTAGCAGCTGCTGCATGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001037806.3-753s21c1
Sequence:CCGGTTCGGAAGAAGGCCCAGATTCCTCGAGGAATCTGGGCCTTCTTCCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037806.3-1860s21c1
Sequence:CCGGCTCCCTGCTATGAGAACATTCCTCGAGGAATGTTCTCATAGCAGGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)