EMAIL THIS PAGE TO A FRIEND

NCKIPSD

NCK interacting protein with SH3 domain

119 Gene Product Result for
Synonyms: AF3P21 DIP DIP1 ORF1 SPIN90 VIP54 WASLBP WISH
UniProtKB ID: Q9NZQ3, B4DFL5, Q6GU34, Q6SPF3, Q8TC10, Q9UGM8
Gene ID:
Human(51517) Summary: The protein encoded by this gene is localized exclusively in the cell nucleus. It plays a role in signal transduction, and may function in the maintenance of sarcomeres and in the assembly of myofibrils into sarcomeres. It also plays an important role in stress fiber formation. The gene is involved in therapy-related leukemia by a chromosomal translocation t(3;11)(p21;q23) that involves this gene and the myeloid/lymphoid leukemia gene. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
Mouse(80987) NCK interacting protein with SH3 domain
Rat(301009) NCK interacting protein with SH3 domain
sheep(101118738) NCK interacting protein with SH3 domain
domestic guinea pig(100727987) NCK interacting protein with SH3 domain
naked mole-rat(101723141) NCK interacting protein with SH3 domain
Zebrafish(100003986) NCK interacting protein with SH3 domain
cow(516941) NCK interacting protein with SH3 domain
domestic cat(101099944) NCK interacting protein with SH3 domain
dog(484776) NCK interacting protein with SH3 domain
chicken(770439) NCK interacting protein with SH3 domain
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030729 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030729 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030729 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016453 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016453 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016453 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU227771 MISSION® esiRNA esiRNA targeting human NCKIPSD human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016453 Rosetta Predictions human pricing
NM_184231 Rosetta Predictions human pricing
NM_001106857 Rosetta Predictions rat pricing
NM_030729 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016453 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075762 predicted 1835
2 SASI_Hs01_00075763 predicted 2050
3 SASI_Hs01_00075764 predicted 1986
4 SASI_Hs01_00075765 predicted 2197
5 SASI_Hs02_00349490 predicted 910
6 SASI_Hs01_00075766 predicted 1821
7 SASI_Hs01_00075767 predicted 1097
8 SASI_Hs01_00075768 predicted 1536
9 SASI_Hs01_00075770 predicted 2086
10 SASI_Hs02_00349491 predicted 940
11 SASI_Hs01_00075769 predicted 1952
12 SASI_Hs01_00075771 predicted 292
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_184231 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209476 predicted 1812
2 SASI_Hs01_00209477 predicted 2027
3 SASI_Hs01_00209478 predicted 1966
4 SASI_Hs01_00209479 predicted 2182
5 SASI_Hs02_00371354 predicted 888
6 SASI_Hs01_00209480 predicted 1801
7 SASI_Hs01_00209481 predicted 1078
8 SASI_Hs01_00209482 predicted 1517
9 SASI_Hs01_00209484 predicted 2057
10 SASI_Hs02_00371355 predicted 918
11 SASI_Hs01_00209483 predicted 1936
12 SASI_Hs01_00209485 predicted 294
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106857 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223086 predicted 371
2 SASI_Rn02_00223087 predicted 1806
3 SASI_Rn02_00223088 predicted 1010
4 SASI_Rn02_00223089 predicted 296
5 SASI_Rn02_00223090 predicted 340
6 SASI_Rn02_00223091 predicted 267
7 SASI_Rn02_00223092 predicted 265
8 SASI_Rn02_00223093 predicted 1052
9 SASI_Rn02_00223094 predicted 1026
10 SASI_Rn02_00223095 predicted 519
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030729 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122072 predicted 1976
2 SASI_Mm01_00122073 predicted 2188
3 SASI_Mm02_00336920 predicted 1792
4 SASI_Mm01_00122074 predicted 1823
5 SASI_Mm01_00122075 predicted 471
6 SASI_Mm01_00122076 predicted 382
7 SASI_Mm01_00122077 predicted 923
8 SASI_Mm01_00122078 predicted 1044
9 SASI_Mm01_00122079 predicted 272
10 SASI_Mm01_00122080 predicted 1040
11 SASI_Mm01_00122081 predicted 1992
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030729
VALIDATED
NCKIPSD MISSION shRNA Bacterial Glycerol Stock
NCK interacting protein with SH3 domain
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030729.4-285s21c1
Sequence:CCGGCAAGATGTCCTCCAAGCTATTCTCGAGAATAGCTTGGAGGACATCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030729.1-1748s1c1
Sequence:CCGGGAATGTCATCATGGCTGCCTTCTCGAGAAGGCAGCCATGATGACATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337904    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030729.4-2327s21c1
Sequence:CCGGACCGACACTGCGAGGTGATAACTCGAGTTATCACCTCGCAGTGTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030729.4-1979s21c1
Sequence:CCGGCACAGACATGATGGCGCTTATCTCGAGATAAGCGCCATCATGTCTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030729.4-2189s21c1
Sequence:CCGGCCGTATGATTGTCCAAGAGATCTCGAGATCTCTTGGACAATCATACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030729.1-249s1c1
Sequence:CCGGCAAGATGTCCTCCAAGCTATTCTCGAGAATAGCTTGGAGGACATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030729.1-1937s1c1
Sequence:CCGGCACAGACATGATGGCGCTTATCTCGAGATAAGCGCCATCATGTCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030729.1-2144s1c1
Sequence:CCGGCCGTATGATTGTCCAAGAGATCTCGAGATCTCTTGGACAATCATACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030729
VALIDATED
NCKIPSD MISSION shRNA shRNA Plasmid DNA
NCK interacting protein with SH3 domain
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030729.4-285s21c1
Sequence:CCGGCAAGATGTCCTCCAAGCTATTCTCGAGAATAGCTTGGAGGACATCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030729.1-1748s1c1
Sequence:CCGGGAATGTCATCATGGCTGCCTTCTCGAGAAGGCAGCCATGATGACATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337904    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030729.4-2327s21c1
Sequence:CCGGACCGACACTGCGAGGTGATAACTCGAGTTATCACCTCGCAGTGTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030729.4-1979s21c1
Sequence:CCGGCACAGACATGATGGCGCTTATCTCGAGATAAGCGCCATCATGTCTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030729.4-2189s21c1
Sequence:CCGGCCGTATGATTGTCCAAGAGATCTCGAGATCTCTTGGACAATCATACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030729.1-249s1c1
Sequence:CCGGCAAGATGTCCTCCAAGCTATTCTCGAGAATAGCTTGGAGGACATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030729.1-1937s1c1
Sequence:CCGGCACAGACATGATGGCGCTTATCTCGAGATAAGCGCCATCATGTCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030729.1-2144s1c1
Sequence:CCGGCCGTATGATTGTCCAAGAGATCTCGAGATCTCTTGGACAATCATACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030729
VALIDATED
NCKIPSD MISSION shRNA Lentiviral Transduction Particles
NCK interacting protein with SH3 domain
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030729.4-285s21c1
Sequence:CCGGCAAGATGTCCTCCAAGCTATTCTCGAGAATAGCTTGGAGGACATCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030729.1-1748s1c1
Sequence:CCGGGAATGTCATCATGGCTGCCTTCTCGAGAAGGCAGCCATGATGACATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337904    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030729.4-2327s21c1
Sequence:CCGGACCGACACTGCGAGGTGATAACTCGAGTTATCACCTCGCAGTGTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030729.4-1979s21c1
Sequence:CCGGCACAGACATGATGGCGCTTATCTCGAGATAAGCGCCATCATGTCTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030729.4-2189s21c1
Sequence:CCGGCCGTATGATTGTCCAAGAGATCTCGAGATCTCTTGGACAATCATACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030729.1-249s1c1
Sequence:CCGGCAAGATGTCCTCCAAGCTATTCTCGAGAATAGCTTGGAGGACATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030729.1-1937s1c1
Sequence:CCGGCACAGACATGATGGCGCTTATCTCGAGATAAGCGCCATCATGTCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030729.1-2144s1c1
Sequence:CCGGCCGTATGATTGTCCAAGAGATCTCGAGATCTCTTGGACAATCATACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016453
VALIDATED
NCKIPSD MISSION shRNA Bacterial Glycerol Stock
NCK interacting protein with SH3 domain
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000141072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016453.2-1334s1c1
Sequence:CCGGCTAGAGGAGCTGCTGCATATTCTCGAGAATATGCAGCAGCTCCTCTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016453.2-1359s1c1
Sequence:CCGGCTGATGCAGACCCTGAAGTTTCTCGAGAAACTTCAGGGTCTGCATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_016453.2-908s1c1
Sequence:CCGGGCAGAAGAAGAAGTGGCAACTCTCGAGAGTTGCCACTTCTTCTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142541    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_016453.2-2841s1c1
Sequence:CCGGGATGGCACTGAGAAAGCCAATCTCGAGATTGGCTTTCTCAGTGCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016453.2-1334s21c1
Sequence:CCGGCTAGAGGAGCTGCTGCATATTCTCGAGAATATGCAGCAGCTCCTCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278445    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016453.2-2841s21c1
Sequence:CCGGGATGGCACTGAGAAAGCCAATCTCGAGATTGGCTTTCTCAGTGCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278444    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016453.2-2780s21c1
Sequence:CCGGCTGCTTTGAAAGCGGGATCTTCTCGAGAAGATCCCGCTTTCAAAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278442    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016453.2-2666s21c1
Sequence:CCGGCCAGCTCTATTCTTTGCCTTACTCGAGTAAGGCAAAGAATAGAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016453.2-908s21c1
Sequence:CCGGGCAGAAGAAGAAGTGGCAACTCTCGAGAGTTGCCACTTCTTCTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_016453.2-2780s1c1
Sequence:CCGGCTGCTTTGAAAGCGGGATCTTCTCGAGAAGATCCCGCTTTCAAAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122103    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_016453.2-2666s1c1
Sequence:CCGGCCAGCTCTATTCTTTGCCTTACTCGAGTAAGGCAAAGAATAGAGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016453
VALIDATED
NCKIPSD MISSION shRNA shRNA Plasmid DNA
NCK interacting protein with SH3 domain
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000141072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016453.2-1334s1c1
Sequence:CCGGCTAGAGGAGCTGCTGCATATTCTCGAGAATATGCAGCAGCTCCTCTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016453.2-1359s1c1
Sequence:CCGGCTGATGCAGACCCTGAAGTTTCTCGAGAAACTTCAGGGTCTGCATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_016453.2-908s1c1
Sequence:CCGGGCAGAAGAAGAAGTGGCAACTCTCGAGAGTTGCCACTTCTTCTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142541    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_016453.2-2841s1c1
Sequence:CCGGGATGGCACTGAGAAAGCCAATCTCGAGATTGGCTTTCTCAGTGCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016453.2-1334s21c1
Sequence:CCGGCTAGAGGAGCTGCTGCATATTCTCGAGAATATGCAGCAGCTCCTCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278445    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016453.2-2841s21c1
Sequence:CCGGGATGGCACTGAGAAAGCCAATCTCGAGATTGGCTTTCTCAGTGCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278444    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016453.2-2780s21c1
Sequence:CCGGCTGCTTTGAAAGCGGGATCTTCTCGAGAAGATCCCGCTTTCAAAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278442    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016453.2-2666s21c1
Sequence:CCGGCCAGCTCTATTCTTTGCCTTACTCGAGTAAGGCAAAGAATAGAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016453.2-908s21c1
Sequence:CCGGGCAGAAGAAGAAGTGGCAACTCTCGAGAGTTGCCACTTCTTCTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_016453.2-2780s1c1
Sequence:CCGGCTGCTTTGAAAGCGGGATCTTCTCGAGAAGATCCCGCTTTCAAAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122103    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_016453.2-2666s1c1
Sequence:CCGGCCAGCTCTATTCTTTGCCTTACTCGAGTAAGGCAAAGAATAGAGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016453
VALIDATED
NCKIPSD MISSION shRNA Lentiviral Transduction Particles
NCK interacting protein with SH3 domain
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000141072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016453.2-1334s1c1
Sequence:CCGGCTAGAGGAGCTGCTGCATATTCTCGAGAATATGCAGCAGCTCCTCTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016453.2-1359s1c1
Sequence:CCGGCTGATGCAGACCCTGAAGTTTCTCGAGAAACTTCAGGGTCTGCATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_016453.2-908s1c1
Sequence:CCGGGCAGAAGAAGAAGTGGCAACTCTCGAGAGTTGCCACTTCTTCTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142541    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_016453.2-2841s1c1
Sequence:CCGGGATGGCACTGAGAAAGCCAATCTCGAGATTGGCTTTCTCAGTGCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016453.2-1334s21c1
Sequence:CCGGCTAGAGGAGCTGCTGCATATTCTCGAGAATATGCAGCAGCTCCTCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278445    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016453.2-2841s21c1
Sequence:CCGGGATGGCACTGAGAAAGCCAATCTCGAGATTGGCTTTCTCAGTGCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278444    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016453.2-2780s21c1
Sequence:CCGGCTGCTTTGAAAGCGGGATCTTCTCGAGAAGATCCCGCTTTCAAAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278442    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016453.2-2666s21c1
Sequence:CCGGCCAGCTCTATTCTTTGCCTTACTCGAGTAAGGCAAAGAATAGAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016453.2-908s21c1
Sequence:CCGGGCAGAAGAAGAAGTGGCAACTCTCGAGAGTTGCCACTTCTTCTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_016453.2-2780s1c1
Sequence:CCGGCTGCTTTGAAAGCGGGATCTTCTCGAGAAGATCCCGCTTTCAAAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122103    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_016453.2-2666s1c1
Sequence:CCGGCCAGCTCTATTCTTTGCCTTACTCGAGTAAGGCAAAGAATAGAGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)