EMAIL THIS PAGE TO A FRIEND

NCL

nucleolin

66 Gene Product Result for
Synonyms: C23
UniProtKB ID: P19338, Q53SK1, Q8NB06, Q9UCF0, Q9UDG1
Gene ID:
Human(4691) Summary: Nucleolin (NCL), a eukaryotic nucleolar phosphoprotein, is involved in the synthesis and maturation of ribosomes. It is located mainly in dense fibrillar regions of the nucleolus. Human NCL gene consists of 14 exons with 13 introns and spans approximately 11kb. The intron 11 of the NCL gene encodes a small nucleolar RNA, termed U20. [provided by RefSeq, Jul 2008]
Mouse(17975) nucleolin
Rat(25135) nucleolin
Zebrafish(767714) nucleolin
cow(497013) nucleolin
Horse(100034004) nucleolin
chicken(396201) nucleolin
dog(608445) nucleolin
sheep(101107846) nucleolin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010880 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010880 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010880 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005381 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005381 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005381 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005381 Rosetta Predictions human pricing
NM_012749 Rosetta Predictions rat pricing
NM_010880 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005381 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116210 predicted 1242
2 SASI_Hs01_00116211 predicted 208
3 SASI_Hs02_00339491 predicted 274
4 SASI_Hs01_00116212 predicted 1773
5 SASI_Hs01_00116213 predicted 1491
6 SASI_Hs01_00116214 predicted 1247
7 SASI_Hs01_00116215 predicted 1556
8 SASI_Hs01_00116216 predicted 1338
9 SASI_Hs01_00116217 predicted 1344
10 SASI_Hs01_00116218 predicted 1219
11 SASI_Hs01_00116219 predicted 1159
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012749 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260106 predicted 421
2 SASI_Rn01_00122317 predicted 1656
3 SASI_Rn02_00260107 predicted 1651
4 SASI_Rn01_00122318 predicted 1943
5 SASI_Rn02_00260108 predicted 1747
6 SASI_Rn01_00122319 predicted 431
7 SASI_Rn02_00260109 predicted 1244
8 SASI_Rn01_00122321 predicted 1956
9 SASI_Rn01_00122322 predicted 1772
10 SASI_Rn02_00260110 predicted 1156
11 SASI_Rn01_00122320 predicted 1030
12 SASI_Rn01_00122323 predicted 1054
13 SASI_Rn01_00122324 predicted 281
14 SASI_Rn01_00122325 predicted 1458
15 SASI_Rn01_00122326 predicted 1041
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010880 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319567 predicted 1790
2 SASI_Mm02_00319568 predicted 1616
3 SASI_Mm02_00319569 predicted 1646
4 SASI_Mm02_00319570 predicted 1438
5 SASI_Mm02_00319571 predicted 1345
6 SASI_Mm02_00319572 predicted 1729
7 SASI_Mm02_00319573 predicted 1873
8 SASI_Mm02_00319574 predicted 1745
9 SASI_Mm02_00319575 predicted 1258
10 SASI_Mm02_00319576 predicted 1589
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010880
VALIDATED
NCL MISSION shRNA Bacterial Glycerol Stock
nucleolin
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010880.2-1657s1c1
Sequence:CCGGCCTTTCCTACAGTGCAACAAACTCGAGTTTGTTGCACTGTAGGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010880.2-2276s1c1
Sequence:CCGGCAAGGAAAGAAGACGAAGTTTCTCGAGAAACTTCGTCTTCTTTCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010880.2-1358s1c1
Sequence:CCGGGCAAGAACACTTCTAGCCAAACTCGAGTTTGGCTAGAAGTGTTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010880.2-583s1c1
Sequence:CCGGGAACGGTAAGAATGCCAAGAACTCGAGTTCTTGGCATTCTTACCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010880.2-677s1c1
Sequence:CCGGGATGAGTTTGAGCCACCAATACTCGAGTATTGGTGGCTCAAACTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010880.3-1412s21c1
Sequence:CCGGGCAAGAACACTTCTAGCCAAACTCGAGTTTGGCTAGAAGTGTTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010880.3-1711s21c1
Sequence:CCGGCCTTTCCTACAGTGCAACAAACTCGAGTTTGTTGCACTGTAGGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010880.3-637s21c1
Sequence:CCGGGAACGGTAAGAATGCCAAGAACTCGAGTTCTTGGCATTCTTACCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010880.3-2330s21c1
Sequence:CCGGCAAGGAAAGAAGACGAAGTTTCTCGAGAAACTTCGTCTTCTTTCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010880
VALIDATED
NCL MISSION shRNA shRNA Plasmid DNA
nucleolin
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010880.2-1657s1c1
Sequence:CCGGCCTTTCCTACAGTGCAACAAACTCGAGTTTGTTGCACTGTAGGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010880.2-2276s1c1
Sequence:CCGGCAAGGAAAGAAGACGAAGTTTCTCGAGAAACTTCGTCTTCTTTCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010880.2-1358s1c1
Sequence:CCGGGCAAGAACACTTCTAGCCAAACTCGAGTTTGGCTAGAAGTGTTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010880.2-583s1c1
Sequence:CCGGGAACGGTAAGAATGCCAAGAACTCGAGTTCTTGGCATTCTTACCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010880.2-677s1c1
Sequence:CCGGGATGAGTTTGAGCCACCAATACTCGAGTATTGGTGGCTCAAACTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010880.3-1412s21c1
Sequence:CCGGGCAAGAACACTTCTAGCCAAACTCGAGTTTGGCTAGAAGTGTTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010880.3-1711s21c1
Sequence:CCGGCCTTTCCTACAGTGCAACAAACTCGAGTTTGTTGCACTGTAGGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010880.3-637s21c1
Sequence:CCGGGAACGGTAAGAATGCCAAGAACTCGAGTTCTTGGCATTCTTACCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010880.3-2330s21c1
Sequence:CCGGCAAGGAAAGAAGACGAAGTTTCTCGAGAAACTTCGTCTTCTTTCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010880
VALIDATED
NCL MISSION shRNA Lentiviral Transduction Particles
nucleolin
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010880.2-1657s1c1
Sequence:CCGGCCTTTCCTACAGTGCAACAAACTCGAGTTTGTTGCACTGTAGGAAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010880.2-2276s1c1
Sequence:CCGGCAAGGAAAGAAGACGAAGTTTCTCGAGAAACTTCGTCTTCTTTCCTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010880.2-1358s1c1
Sequence:CCGGGCAAGAACACTTCTAGCCAAACTCGAGTTTGGCTAGAAGTGTTCTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010880.2-583s1c1
Sequence:CCGGGAACGGTAAGAATGCCAAGAACTCGAGTTCTTGGCATTCTTACCGTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010880.2-677s1c1
Sequence:CCGGGATGAGTTTGAGCCACCAATACTCGAGTATTGGTGGCTCAAACTCATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010880.3-1412s21c1
Sequence:CCGGGCAAGAACACTTCTAGCCAAACTCGAGTTTGGCTAGAAGTGTTCTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010880.3-1711s21c1
Sequence:CCGGCCTTTCCTACAGTGCAACAAACTCGAGTTTGTTGCACTGTAGGAAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010880.3-637s21c1
Sequence:CCGGGAACGGTAAGAATGCCAAGAACTCGAGTTCTTGGCATTCTTACCGTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010880.3-2330s21c1
Sequence:CCGGCAAGGAAAGAAGACGAAGTTTCTCGAGAAACTTCGTCTTCTTTCCTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005381
VALIDATED
NCL MISSION shRNA Bacterial Glycerol Stock
nucleolin
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005381.2-1577s1c1
Sequence:CCGGGCACTTGGAGTGGTGAATCAACTCGAGTTGATTCACCACTCCAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005381.2-2037s1c1
Sequence:CCGGCGGTGAAATTGATGGAAATAACTCGAGTTATTTCCATCAATTTCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005381.2-1509s1c1
Sequence:CCGGGCGATCTATTTCCCTGTACTACTCGAGTAGTACAGGGAAATAGATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062283    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005381.2-2396s1c1
Sequence:CCGGCCTTGGAAATCCGTCTAGTTACTCGAGTAACTAGACGGATTTCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_005381.2-1926s21c1
Sequence:CCGGCGTTCGGGCAAGGATAGTTACCTCGAGGTAACTATCCTTGCCCGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005381.2-202s1c1
Sequence:CCGGCCAAAGGAGGTAGAAGAAGATCTCGAGATCTTCTTCTACCTCCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_005381.2-1577s21c1
Sequence:CCGGGCACTTGGAGTGGTGAATCAACTCGAGTTGATTCACCACTCCAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_005381.2-1423s21c1
Sequence:CCGGAGTAAAGGGATTGCTTATATTCTCGAGAATATAAGCAATCCCTTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287078    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_005381.2-2396s21c1
Sequence:CCGGCCTTGGAAATCCGTCTAGTTACTCGAGTAACTAGACGGATTTCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005381.2-2037s21c1
Sequence:CCGGCGGTGAAATTGATGGAAATAACTCGAGTTATTTCCATCAATTTCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005381
VALIDATED
NCL MISSION shRNA shRNA Plasmid DNA
nucleolin
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005381.2-1577s1c1
Sequence:CCGGGCACTTGGAGTGGTGAATCAACTCGAGTTGATTCACCACTCCAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005381.2-2037s1c1
Sequence:CCGGCGGTGAAATTGATGGAAATAACTCGAGTTATTTCCATCAATTTCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005381.2-1509s1c1
Sequence:CCGGGCGATCTATTTCCCTGTACTACTCGAGTAGTACAGGGAAATAGATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062283    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005381.2-2396s1c1
Sequence:CCGGCCTTGGAAATCCGTCTAGTTACTCGAGTAACTAGACGGATTTCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_005381.2-1926s21c1
Sequence:CCGGCGTTCGGGCAAGGATAGTTACCTCGAGGTAACTATCCTTGCCCGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005381.2-202s1c1
Sequence:CCGGCCAAAGGAGGTAGAAGAAGATCTCGAGATCTTCTTCTACCTCCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_005381.2-1577s21c1
Sequence:CCGGGCACTTGGAGTGGTGAATCAACTCGAGTTGATTCACCACTCCAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_005381.2-1423s21c1
Sequence:CCGGAGTAAAGGGATTGCTTATATTCTCGAGAATATAAGCAATCCCTTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287078    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_005381.2-2396s21c1
Sequence:CCGGCCTTGGAAATCCGTCTAGTTACTCGAGTAACTAGACGGATTTCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005381.2-2037s21c1
Sequence:CCGGCGGTGAAATTGATGGAAATAACTCGAGTTATTTCCATCAATTTCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005381
VALIDATED
NCL MISSION shRNA Lentiviral Transduction Particles
nucleolin
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005381.2-1577s1c1
Sequence:CCGGGCACTTGGAGTGGTGAATCAACTCGAGTTGATTCACCACTCCAAGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005381.2-2037s1c1
Sequence:CCGGCGGTGAAATTGATGGAAATAACTCGAGTTATTTCCATCAATTTCACCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005381.2-1509s1c1
Sequence:CCGGGCGATCTATTTCCCTGTACTACTCGAGTAGTACAGGGAAATAGATCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062283    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005381.2-2396s1c1
Sequence:CCGGCCTTGGAAATCCGTCTAGTTACTCGAGTAACTAGACGGATTTCCAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_005381.2-1926s21c1
Sequence:CCGGCGTTCGGGCAAGGATAGTTACCTCGAGGTAACTATCCTTGCCCGAACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005381.2-202s1c1
Sequence:CCGGCCAAAGGAGGTAGAAGAAGATCTCGAGATCTTCTTCTACCTCCTTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_005381.2-1577s21c1
Sequence:CCGGGCACTTGGAGTGGTGAATCAACTCGAGTTGATTCACCACTCCAAGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_005381.2-1423s21c1
Sequence:CCGGAGTAAAGGGATTGCTTATATTCTCGAGAATATAAGCAATCCCTTTACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287078    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_005381.2-2396s21c1
Sequence:CCGGCCTTGGAAATCCGTCTAGTTACTCGAGTAACTAGACGGATTTCCAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005381.2-2037s21c1
Sequence:CCGGCGGTGAAATTGATGGAAATAACTCGAGTTATTTCCATCAATTTCACCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)