EMAIL THIS PAGE TO A FRIEND

NCLN

nicalin

85 Gene Product Result for
Synonyms: NET59
Gene ID:
Mouse(103425) nicalin homolog (zebrafish)
Rat(314648) nicalin
chicken(426048) nicalin
cow(531802) nicalin
dog(485062) nicalin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020170 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020170 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020170 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134009 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134009 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134009 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020170 Rosetta Predictions human pricing
NM_001014082 Rosetta Predictions rat pricing
NM_134009 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020170 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053845 predicted 1419
2 SASI_Hs01_00053846 predicted 816
3 SASI_Hs02_00353081 predicted 545
4 SASI_Hs01_00053847 predicted 608
5 SASI_Hs01_00053848 predicted 1669
6 SASI_Hs01_00053850 predicted 1384
7 SASI_Hs01_00053851 predicted 541
8 SASI_Hs01_00053852 predicted 1212
9 SASI_Hs01_00053853 predicted 1230
10 SASI_Hs01_00053854 predicted 1386
11 SASI_Hs01_00053849 predicted 968
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014082 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089658 predicted 248
2 SASI_Rn01_00089659 predicted 872
3 SASI_Rn01_00089661 predicted 1672
4 SASI_Rn01_00089662 predicted 270
5 SASI_Rn01_00089663 predicted 1821
6 SASI_Rn01_00089664 predicted 666
7 SASI_Rn01_00089665 predicted 1324
8 SASI_Rn01_00089667 predicted 877
9 SASI_Rn02_00201503 predicted 660
10 SASI_Rn02_00201504 predicted 663
11 SASI_Rn01_00089660 predicted 1765
12 SASI_Rn01_00089666 predicted 1868
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134009 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339152 predicted 1620
2 SASI_Mm01_00032965 predicted 893
3 SASI_Mm01_00032966 predicted 269
4 SASI_Mm01_00032967 predicted 1693
5 SASI_Mm01_00032968 predicted 1887
6 SASI_Mm01_00032969 predicted 1524
7 SASI_Mm02_00339153 predicted 1783
8 SASI_Mm01_00032971 predicted 285
9 SASI_Mm01_00032972 predicted 1842
10 SASI_Mm02_00339154 predicted 1355
11 SASI_Mm01_00032963 predicted 1786
12 SASI_Mm01_00032964 predicted 2263
13 SASI_Mm01_00032970 predicted 755
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020170
NCLN MISSION shRNA Bacterial Glycerol Stock
nicalin
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020170.3-1219s21c1
Sequence:CCGGCATGGTGCACAAGCGGATCAACTCGAGTTGATCCGCTTGTGCACCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020170.3-1389s21c1
Sequence:CCGGCCCGTAACACGAGGATCATTGCTCGAGCAATGATCCTCGTGTTACGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432559    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020170.3-2312s21c1
Sequence:CCGGGTGGCGTGGACATGGTTATTTCTCGAGAAATAACCATGTCCACGCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020170.3-1684s1c1
Sequence:CCGGGAAGCAAGTGATGAATGCGTACTCGAGTACGCATTCATCACTTGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020170.3-737s1c1
Sequence:CCGGGCCGTGAGTGACTGGCTGATTCTCGAGAATCAGCCAGTCACTCACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020170.3-1468s1c1
Sequence:CCGGGCCGGTGTTCACAGAGCAGATCTCGAGATCTGCTCTGTGAACACCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020170.3-1968s1c1
Sequence:CCGGCGGTGGTTGGAACACTGAATTCTCGAGAATTCAGTGTTCCAACCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020170.3-987s1c1
Sequence:CCGGGCAAGTTTAACTACCAGGGAACTCGAGTTCCCTGGTAGTTAAACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020170
NCLN MISSION shRNA shRNA Plasmid DNA
nicalin
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020170.3-1219s21c1
Sequence:CCGGCATGGTGCACAAGCGGATCAACTCGAGTTGATCCGCTTGTGCACCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020170.3-1389s21c1
Sequence:CCGGCCCGTAACACGAGGATCATTGCTCGAGCAATGATCCTCGTGTTACGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432559    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020170.3-2312s21c1
Sequence:CCGGGTGGCGTGGACATGGTTATTTCTCGAGAAATAACCATGTCCACGCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020170.3-1684s1c1
Sequence:CCGGGAAGCAAGTGATGAATGCGTACTCGAGTACGCATTCATCACTTGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020170.3-737s1c1
Sequence:CCGGGCCGTGAGTGACTGGCTGATTCTCGAGAATCAGCCAGTCACTCACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020170.3-1468s1c1
Sequence:CCGGGCCGGTGTTCACAGAGCAGATCTCGAGATCTGCTCTGTGAACACCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020170.3-1968s1c1
Sequence:CCGGCGGTGGTTGGAACACTGAATTCTCGAGAATTCAGTGTTCCAACCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020170.3-987s1c1
Sequence:CCGGGCAAGTTTAACTACCAGGGAACTCGAGTTCCCTGGTAGTTAAACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020170
NCLN MISSION shRNA Lentiviral Transduction Particles
nicalin
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020170.3-1219s21c1
Sequence:CCGGCATGGTGCACAAGCGGATCAACTCGAGTTGATCCGCTTGTGCACCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020170.3-1389s21c1
Sequence:CCGGCCCGTAACACGAGGATCATTGCTCGAGCAATGATCCTCGTGTTACGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432559    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020170.3-2312s21c1
Sequence:CCGGGTGGCGTGGACATGGTTATTTCTCGAGAAATAACCATGTCCACGCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020170.3-1684s1c1
Sequence:CCGGGAAGCAAGTGATGAATGCGTACTCGAGTACGCATTCATCACTTGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020170.3-737s1c1
Sequence:CCGGGCCGTGAGTGACTGGCTGATTCTCGAGAATCAGCCAGTCACTCACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020170.3-1468s1c1
Sequence:CCGGGCCGGTGTTCACAGAGCAGATCTCGAGATCTGCTCTGTGAACACCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020170.3-1968s1c1
Sequence:CCGGCGGTGGTTGGAACACTGAATTCTCGAGAATTCAGTGTTCCAACCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020170.3-987s1c1
Sequence:CCGGGCAAGTTTAACTACCAGGGAACTCGAGTTCCCTGGTAGTTAAACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134009
VALIDATED
NCLN MISSION shRNA Bacterial Glycerol Stock
nicalin
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000325417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134009.3-1609s21c1
Sequence:CCGGGTTTGTCTTCTATGACCAGTTCTCGAGAACTGGTCATAGAAGACAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134009.3-470s21c1
Sequence:CCGGGTCCGGCAATTCATGGAGATTCTCGAGAATCTCCATGAATTGCCGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134009.3-753s21c1
Sequence:CCGGCCATTGTCATCGTGGCTCATTCTCGAGAATGAGCCACGATGACAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325489    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134009.3-2483s21c1
Sequence:CCGGCCACGGTGAATCAATTCAATACTCGAGTATTGAATTGATTCACCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134009.3-1414s21c1
Sequence:CCGGGCCAGTGTTCACGGAGCAGATCTCGAGATCTGCTCCGTGAACACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134009.1-2477s1c1
Sequence:CCGGCCACGGTGAATCAATTCAATACTCGAGTATTGAATTGATTCACCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134009.1-1603s1c1
Sequence:CCGGGTTTGTCTTCTATGACCAGTTCTCGAGAACTGGTCATAGAAGACAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134009.1-1408s1c1
Sequence:CCGGGCCAGTGTTCACGGAGCAGATCTCGAGATCTGCTCCGTGAACACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134009.1-464s1c1
Sequence:CCGGGTCCGGCAATTCATGGAGATTCTCGAGAATCTCCATGAATTGCCGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134009.1-747s1c1
Sequence:CCGGCCATTGTCATCGTGGCTCATTCTCGAGAATGAGCCACGATGACAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134009
VALIDATED
NCLN MISSION shRNA shRNA Plasmid DNA
nicalin
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000325417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134009.3-1609s21c1
Sequence:CCGGGTTTGTCTTCTATGACCAGTTCTCGAGAACTGGTCATAGAAGACAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134009.3-470s21c1
Sequence:CCGGGTCCGGCAATTCATGGAGATTCTCGAGAATCTCCATGAATTGCCGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134009.3-753s21c1
Sequence:CCGGCCATTGTCATCGTGGCTCATTCTCGAGAATGAGCCACGATGACAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325489    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134009.3-2483s21c1
Sequence:CCGGCCACGGTGAATCAATTCAATACTCGAGTATTGAATTGATTCACCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134009.3-1414s21c1
Sequence:CCGGGCCAGTGTTCACGGAGCAGATCTCGAGATCTGCTCCGTGAACACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134009.1-2477s1c1
Sequence:CCGGCCACGGTGAATCAATTCAATACTCGAGTATTGAATTGATTCACCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134009.1-1603s1c1
Sequence:CCGGGTTTGTCTTCTATGACCAGTTCTCGAGAACTGGTCATAGAAGACAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134009.1-1408s1c1
Sequence:CCGGGCCAGTGTTCACGGAGCAGATCTCGAGATCTGCTCCGTGAACACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134009.1-464s1c1
Sequence:CCGGGTCCGGCAATTCATGGAGATTCTCGAGAATCTCCATGAATTGCCGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134009.1-747s1c1
Sequence:CCGGCCATTGTCATCGTGGCTCATTCTCGAGAATGAGCCACGATGACAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134009
VALIDATED
NCLN MISSION shRNA Lentiviral Transduction Particles
nicalin
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000325417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134009.3-1609s21c1
Sequence:CCGGGTTTGTCTTCTATGACCAGTTCTCGAGAACTGGTCATAGAAGACAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134009.3-470s21c1
Sequence:CCGGGTCCGGCAATTCATGGAGATTCTCGAGAATCTCCATGAATTGCCGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134009.3-753s21c1
Sequence:CCGGCCATTGTCATCGTGGCTCATTCTCGAGAATGAGCCACGATGACAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325489    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134009.3-2483s21c1
Sequence:CCGGCCACGGTGAATCAATTCAATACTCGAGTATTGAATTGATTCACCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134009.3-1414s21c1
Sequence:CCGGGCCAGTGTTCACGGAGCAGATCTCGAGATCTGCTCCGTGAACACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134009.1-2477s1c1
Sequence:CCGGCCACGGTGAATCAATTCAATACTCGAGTATTGAATTGATTCACCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134009.1-1603s1c1
Sequence:CCGGGTTTGTCTTCTATGACCAGTTCTCGAGAACTGGTCATAGAAGACAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134009.1-1408s1c1
Sequence:CCGGGCCAGTGTTCACGGAGCAGATCTCGAGATCTGCTCCGTGAACACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134009.1-464s1c1
Sequence:CCGGGTCCGGCAATTCATGGAGATTCTCGAGAATCTCCATGAATTGCCGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134009.1-747s1c1
Sequence:CCGGCCATTGTCATCGTGGCTCATTCTCGAGAATGAGCCACGATGACAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)